HUGE

Gene/Protein Characteristic Table for KIAA0396

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01595
Accession No. :	AB007856
Description :	fem-1 homolog b.
HUGO Gene Name :
Clone Name :	hg00180s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0396
Source :	Human adult brain
Note :	We replaced hg00180, former representative clones for KIAA0396 with hg00180s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6497 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4613 bp

Genome contig ID gi51511731f_66257810
PolyA signal sequence
(AGTAAA,-12)
+----*----+----*----+----*----+----
AGGAAAAAATGGTGTTTGTGTTCAGTAAATGTTTG
Flanking genome sequence
(117439 - 117488)
----+----*----+----*----+----*----+----*----+----*
AAAAAAACTACTTTGAGGTTTGTGTCTTTATTAATTATTCAGTGTGCCTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 f 66357810 66375247 2 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 627 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001496275	99.7	fem-1 homolog b...	Equus caballus
XP_592679	99.5	similar to fem-...	Bos taurus
P0C6P7	99.2	Protein fem-1 h...	Rattus norvegicus
Q9Z2G0	99.0	Protein fem-1 h...	Mus musculus
BAE21305	98.9	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058688	3.3e-75	40.7	KIAA1785
AB046856	1.9e-13	34.0	KIAA1636
D86982	2.3e-13	31.2	KIAA0229
AB051515	1.3e-12	30.3	KIAA1728
AB058779	5.3e-12	31.6	KIAA1876

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002110 46 58 PR01415 Ankyrin

IPR002110 100 112 PR01415 Ankyrin

HMMPfam IPR002110 45 77 PF00023 Ankyrin

IPR002110 87 119 PF00023 Ankyrin

IPR002110 120 152 PF00023 Ankyrin

IPR002110 153 185 PF00023 Ankyrin

IPR002110 186 211 PF00023 Ankyrin

IPR002110 218 249 PF00023 Ankyrin

IPR002110 483 530 PF00023 Ankyrin

IPR002110 531 571 PF00023 Ankyrin

HMMSmart IPR002110 45 74 SM00248 Ankyrin

IPR002110 87 116 SM00248 Ankyrin

IPR002110 120 149 SM00248 Ankyrin

IPR002110 153 182 SM00248 Ankyrin

IPR002110 186 215 SM00248 Ankyrin

IPR002110 218 246 SM00248 Ankyrin

IPR002110 483 527 SM00248 Ankyrin

IPR002110 531 570 SM00248 Ankyrin

ProfileScan IPR002110 45 68 PS50088 Ankyrin

IPR002110 45 241 PS50297 Ankyrin

IPR002110 87 119 PS50088 Ankyrin

IPR002110 120 152 PS50088 Ankyrin

IPR002110 153 185 PS50088 Ankyrin

IPR002110 186 218 PS50088 Ankyrin

IPR002110 483 530 PS50088 Ankyrin

IPR002110 483 577 PS50297 Ankyrin

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	46	58	PR01415	Ankyrin
IPR002110	100	112	PR01415	Ankyrin
HMMPfam	IPR002110	45	77	PF00023	Ankyrin
IPR002110	87	119	PF00023	Ankyrin
IPR002110	120	152	PF00023	Ankyrin
IPR002110	153	185	PF00023	Ankyrin
IPR002110	186	211	PF00023	Ankyrin
IPR002110	218	249	PF00023	Ankyrin
IPR002110	483	530	PF00023	Ankyrin
IPR002110	531	571	PF00023	Ankyrin
HMMSmart	IPR002110	45	74	SM00248	Ankyrin
IPR002110	87	116	SM00248	Ankyrin
IPR002110	120	149	SM00248	Ankyrin
IPR002110	153	182	SM00248	Ankyrin
IPR002110	186	215	SM00248	Ankyrin
IPR002110	218	246	SM00248	Ankyrin
IPR002110	483	527	SM00248	Ankyrin
IPR002110	531	570	SM00248	Ankyrin
ProfileScan	IPR002110	45	68	PS50088	Ankyrin
IPR002110	45	241	PS50297	Ankyrin
IPR002110	87	119	PS50088	Ankyrin
IPR002110	120	152	PS50088	Ankyrin
IPR002110	153	185	PS50088	Ankyrin
IPR002110	186	218	PS50088	Ankyrin
IPR002110	483	530	PS50088	Ankyrin
IPR002110	483	577	PS50297	Ankyrin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: AAATCACTAATGGACCTCTGG

Primer_r
: CGGTGATGTCATTCTATTGTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AAATCACTAATGGACCTCTGG
Primer_r	: CGGTGATGTCATTCTATTGTG
PCR product length	: 99 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4613 bp
Genome contig ID	gi51511731f_66257810
PolyA signal sequence (AGTAAA,-12)	+--------+--------+----*----+---- AGGAAAAAATGGTGTTTGTGTTCAGTAAATGTTTG
Flanking genome sequence (117439 - 117488)	----+--------+--------+--------+--------+----* AAAAAAACTACTTTGAGGTTTGTGTCTTTATTAATTATTCAGTGTGCCTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	f	66357810	66375247	2	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0396

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information