HUGE

Gene/Protein Characteristic Table for KIAA1129

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00744
Accession No. :	AB032955
Description :	Kelch-like protein 3.
HUGO Gene Name :	kelch-like 3 (Drosophila) (KLHL3)
Clone Name :	hg04330 [Vector Info]
Flexi ORF Clone :	pF1KSDA1129
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6573 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 4595 bp

Genome contig ID gi51511721r_136881090
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
CCATCCTTTAATTTTAATAAAAGCTGAACTGTGTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACTTTTCTCAGTATTTCATTTCTATAGTCCAGTCTCTCTGCTATGTCTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 r 136981090 137099448 15 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 625 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UH77	100.0	Kelch-like prot...	Homo sapiens
Q5REP9	99.7	Kelch-like prot...	Pongo abelii
AAF20938	99.7	kelch-like prot...	Homo sapiens
XP_001112192	99.3	kelch-like 3 is...	Macaca mulatta
XP_001504377	98.3	similar to Kelc...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040923	7.5e-84	38.8	KIAA1490
AB051474	6.1e-80	37.2	KIAA1687
AB037799	4.6e-74	39.0	KIAA1378
D50922	1.7e-67	37.4	KIAA0132
AB018338	6.6e-67	39.1	KIAA0795

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR006651 478 491 PR00501 Kelch

IPR006651 544 558 PR00501 Kelch

IPR006651 607 619 PR00501 Kelch

HMMPfam IPR013069 78 185 PF00651 BTB/POZ

IPR011705 190 292 PF07707 BTB/Kelch-associated

IPR006652 328 372 PF01344 Kelch repeat type 1

IPR006652 374 419 PF01344 Kelch repeat type 1

IPR006652 421 466 PF01344 Kelch repeat type 1

IPR006652 468 515 PF01344 Kelch repeat type 1

IPR006652 517 562 PF01344 Kelch repeat type 1

IPR006652 564 609 PF01344 Kelch repeat type 1

HMMSmart IPR000210 88 185 SM00225 BTB/POZ-like

IPR006652 340 385 SM00612 Kelch repeat type 1

IPR006652 386 432 SM00612 Kelch repeat type 1

IPR006652 433 479 SM00612 Kelch repeat type 1

IPR006652 480 528 SM00612 Kelch repeat type 1

IPR006652 529 575 SM00612 Kelch repeat type 1

IPR006652 576 623 SM00612 Kelch repeat type 1

ProfileScan IPR000210 88 155 PS50097 BTB/POZ-like

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR006651	478	491	PR00501	Kelch
IPR006651	544	558	PR00501	Kelch
IPR006651	607	619	PR00501	Kelch
HMMPfam	IPR013069	78	185	PF00651	BTB/POZ
IPR011705	190	292	PF07707	BTB/Kelch-associated
IPR006652	328	372	PF01344	Kelch repeat type 1
IPR006652	374	419	PF01344	Kelch repeat type 1
IPR006652	421	466	PF01344	Kelch repeat type 1
IPR006652	468	515	PF01344	Kelch repeat type 1
IPR006652	517	562	PF01344	Kelch repeat type 1
IPR006652	564	609	PF01344	Kelch repeat type 1
HMMSmart	IPR000210	88	185	SM00225	BTB/POZ-like
IPR006652	340	385	SM00612	Kelch repeat type 1
IPR006652	386	432	SM00612	Kelch repeat type 1
IPR006652	433	479	SM00612	Kelch repeat type 1
IPR006652	480	528	SM00612	Kelch repeat type 1
IPR006652	529	575	SM00612	Kelch repeat type 1
IPR006652	576	623	SM00612	Kelch repeat type 1
ProfileScan	IPR000210	88	155	PS50097	BTB/POZ-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTGTGTTTCTACTGACCAAGC

Primer_r
: ACTAGGGTGATTTGATGCTGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTGTGTTTCTACTGACCAAGC
Primer_r	: ACTAGGGTGATTTGATGCTGC
PCR product length	: 201 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	4595 bp
Genome contig ID	gi51511721r_136881090
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CCATCCTTTAATTTTAATAAAAGCTGAACTGTGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACTTTTCTCAGTATTTCATTTCTATAGTCCAGTCTCTCTGCTATGTCTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	r	136981090	137099448	15	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA1129

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information