| HUGE |
Gene/Protein Characteristic Table for KIAA1111 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK01149 |
|---|---|
| Accession No. : | AB029034 |
| Description : | PHD finger protein 8. |
| HUGO Gene Name : | PHD finger protein 8 (PHF8) |
| Clone Name : | hj04651s1 [Vector Info] |
| Flexi ORF Clone : | pF1KA1111
![]() |
| Source : | Human adult brain |
| Note : | We replaced hj04651, former representative clones for KIAA1111 with hj04651s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4695 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1439 bp Genome contig ID gi89161218r_53880877 PolyA signal sequence
(None) +----*----+----*----+----*----+----
TGGGGAATTTAATAGCTACCATGCAGGCCACAGGGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AATTTGTGAGGCTTCTTTTGTCATCTTTGTATCTCCAGTTTGTCTTTCTT
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1084 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : TTCCCCTGTCCTTCCTTCGTG | |
| : GGGTAGTGCCAAATGGAGGTG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : X |
| : GeneBridge 4 | |
| : TTCCCCTGTCCTTCCTTCGTG | |
| : GGGTAGTGCCAAATGGAGGTG | |
| : 126 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |