HUGE

Gene/Protein Characteristic Table for KIAA1100

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01626
Accession No. :	AB029023
Description :	RING finger protein 44.
HUGO Gene Name :	ring finger protein 44 (RNF44)
Clone Name :	hk07907 [Vector Info]
Flexi ORF Clone :	pF1KSDA1100
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4023 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2314 bp

Genome contig ID gi51511721r_175786321
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
GAGGGATATTCACTAATAAATGTATGATGTATACC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACGACCGCCCACGCTGCCTTTGGCTGCCCGTGTCTTTTTGGTGGGAGGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 r 175886321 175896912 11 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 444 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001091221	1.1e-135	98.6	similar to ring...	Macaca mulatta
Q7L0R7	7.7e-134	100.0	RING finger pro...	Homo sapiens
XP_001136577	2.7e-132	99.5	ring finger pro...	Pan troglodytes
XP_001502682	6.6e-127	95.4	similar to RING...	Equus caballus
XP_546217	1.7e-126	96.1	similar to ring...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001841 392 432 PF00097 Zinc finger

HMMSmart IPR001841 392 432 SM00184 Zinc finger

ProfileScan IPR001841 392 433 PS50089 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001841	392	432	PF00097	Zinc finger
HMMSmart	IPR001841	392	432	SM00184	Zinc finger
ProfileScan	IPR001841	392	433	PS50089	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCAGCAGTGATTCCAACAAGC

Primer_r
: GAGAGTAAACAATGGCAAGCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: CCR
Primer_f	: GCAGCAGTGATTCCAACAAGC
Primer_r	: GAGAGTAAACAATGGCAAGCC
PCR product length	: 177 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2314 bp
Genome contig ID	gi51511721r_175786321
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GAGGGATATTCACTAATAAATGTATGATGTATACC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACGACCGCCCACGCTGCCTTTGGCTGCCCGTGTCTTTTTGGTGGGAGGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	r	175886321	175896912	11	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA1100

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information