HUGE

Gene/Protein Characteristic Table for KIAA1091

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK02017
Accession No. :	AB029014
Description :	Rab6-interacting protein 1.
HUGO Gene Name :	DENN/MADD domain containing 5A (DENND5A)
Clone Name :	hk04373 [Vector Info]
Flexi ORF Clone :	pF1KA1091
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4248 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 167 bp

Genome contig ID gi51511727r_9017627
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
AGGATTTTTGGAATAAATAATCTATTTTAGAGTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTTGCTGATTTGCTTTTTACACACTTTCATGTGAAAGAGTGATAGGGAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 r 9117627 9243409 23 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1359 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6IQ26	100.0	DENN domain-con...	Homo sapiens
CAB55932	99.9	hypothetical pr...	Homo sapiens
XP_534048	95.7	similar to RAB6...	Canis lupus fam...
XP_508914	99.7	RAB6 interactin...	Pan troglodytes
Q6PAL8	97.8	DENN domain-con...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051553	3.6e-07	27.4	KIAA1766
AB007945	3.7e-07	24.2	KIAA0476
AB046828	1.6e-06	30.7	KIAA1608
AB033103	2.3e-05	26.7	KIAA1277
AB002356	2.4e-05	24.4	KIAA0358

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR005113 84 210 PF03456 uDENN

IPR001194 274 462 PF02141 DENN

IPR005112 584 660 PF03455 dDENN

IPR004012 881 1018 PF02759 RUN

IPR001024 1029 1131 PF01477 Lipoxygenase

HMMSmart IPR005113 84 210 SM00800 uDENN

IPR001194 274 462 SM00799 DENN

IPR005112 584 660 SM00801 dDENN

IPR004012 956 1019 SM00593 RUN

IPR004012 1290 1350 SM00593 RUN

ProfileScan IPR005113 84 216 PS50946 uDENN

IPR001194 274 462 PS50211 DENN

IPR005112 584 660 PS50947 dDENN

IPR004012 859 1022 PS50826 RUN

IPR001024 1026 1134 PS50095 Lipoxygenase

IPR004012 1206 1354 PS50826 RUN

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005113	84	210	PF03456	uDENN
IPR001194	274	462	PF02141	DENN
IPR005112	584	660	PF03455	dDENN
IPR004012	881	1018	PF02759	RUN
IPR001024	1029	1131	PF01477	Lipoxygenase
HMMSmart	IPR005113	84	210	SM00800	uDENN
IPR001194	274	462	SM00799	DENN
IPR005112	584	660	SM00801	dDENN
IPR004012	956	1019	SM00593	RUN
IPR004012	1290	1350	SM00593	RUN
ProfileScan	IPR005113	84	216	PS50946	uDENN
IPR001194	274	462	PS50211	DENN
IPR005112	584	660	PS50947	dDENN
IPR004012	859	1022	PS50826	RUN
IPR001024	1026	1134	PS50095	Lipoxygenase
IPR004012	1206	1354	PS50826	RUN

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTCAACATCACGCTGGAGACG

Primer_r
: GTCTCCTACTCCTGCACAATC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	167 bp
Genome contig ID	gi51511727r_9017627
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- AGGATTTTTGGAATAAATAATCTATTTTAGAGTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTGCTGATTTGCTTTTTACACACTTTCATGTGAAAGAGTGATAGGGAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	r	9117627	9243409	23	99.8	Perfect prediction

Primer_f	: TTCAACATCACGCTGGAGACG
Primer_r	: GTCTCCTACTCCTGCACAATC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1091

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information