HUGE |
Gene/Protein Characteristic Table for KIAA1091 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK02017 |
---|---|
Accession No. : | AB029014 |
Description : | Rab6-interacting protein 1. |
HUGO Gene Name : | DENN/MADD domain containing 5A (DENND5A) |
Clone Name : | hk04373 [Vector Info] |
Flexi ORF Clone : | pF1KA1091
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4248 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 167 bp Genome contig ID gi51511727r_9017627 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
AGGATTTTTGGAATAAATAATCTATTTTAGAGTTTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATTTGCTGATTTGCTTTTTACACACTTTCATGTGAAAGAGTGATAGGGAG
Chr f/r start end exon identity class ContigView(URL based/DAS) 11 r 9117627 9243409 23 99.8 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1359 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR005113 | 84 | 210 | PF03456 | uDENN |
IPR001194 | 274 | 462 | PF02141 | DENN | |
IPR005112 | 584 | 660 | PF03455 | dDENN | |
IPR004012 | 881 | 1018 | PF02759 | RUN | |
IPR001024 | 1029 | 1131 | PF01477 | Lipoxygenase | |
HMMSmart | IPR005113 | 84 | 210 | SM00800 | uDENN |
IPR001194 | 274 | 462 | SM00799 | DENN | |
IPR005112 | 584 | 660 | SM00801 | dDENN | |
IPR004012 | 956 | 1019 | SM00593 | RUN | |
IPR004012 | 1290 | 1350 | SM00593 | RUN | |
ProfileScan | IPR005113 | 84 | 216 | PS50946 | uDENN |
IPR001194 | 274 | 462 | PS50211 | DENN | |
IPR005112 | 584 | 660 | PS50947 | dDENN | |
IPR004012 | 859 | 1022 | PS50826 | RUN | |
IPR001024 | 1026 | 1134 | PS50095 | Lipoxygenase | |
IPR004012 | 1206 | 1354 | PS50826 | RUN |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TTCAACATCACGCTGGAGACG | |
: GTCTCCTACTCCTGCACAATC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 11 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |