HUGE

Gene/Protein Characteristic Table for KIAA1088

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00735
Accession No. :	AB029011
Description :	Tumor necrosis factor receptor superfamily member 6B precursor.
HUGO Gene Name :	regulator of telomere elongation helicase 1 (RTEL1)
Clone Name :	hk02589s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA1088
Source :	Human adult brain
Note :	We replaced hk02589, former representative clones for KIAA1088 with hk02589s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4945 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 742 bp

Genome contig ID gi51511747f_61661200
PolyA signal sequence
(TATAAA,-34)
+----*----+----*----+----*----+----
TTATAAAGCTTTTTCATAAAACTGGTTGTAGTTGC
Flanking genome sequence
(139297 - 139346)
----+----*----+----*----+----*----+----*----+----*
ACAGCTACTGGGAGGGCAGCCGGGGACACCTGAGCCGCCCGCTGTGCCCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 f 61761200 61800495 37 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1400 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW75244	99.8	hCG22751, isofo...	Homo sapiens
Q9NZ71	99.7	Regulator of te...	Homo sapiens
EAW75240	99.7	hCG22751, isofo...	Homo sapiens
XP_001113864	92.2	similar to regu...	Macaca mulatta
CAH89973	96.5	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006935 14 51 PF04851 Restriction endonuclease

IPR010614 111 272 PF06733 DEAD_2

HMMSmart IPR006554 9 291 SM00488 Helicase-like

IPR006555 563 717 SM00491 Helicase

HMMTigr IPR013020 8 745 TIGR00604 DNA helicase (DNA repair)

ProfileScan IPR014013 7 296 PS51193 Helicase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006935	14	51	PF04851	Restriction endonuclease
IPR010614	111	272	PF06733	DEAD_2
HMMSmart	IPR006554	9	291	SM00488	Helicase-like
IPR006555	563	717	SM00491	Helicase
HMMTigr	IPR013020	8	745	TIGR00604	DNA helicase (DNA repair)
ProfileScan	IPR014013	7	296	PS51193	Helicase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTCAATGTGCCAGGCTCTTCC

Primer_r
: GGAAAGCCACAAAGTCGATGA

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGGGGACAGTCGTGATCTTTG
Primer_r	: CAGGTCATGGGGAGTCAGGTC
PCR product length	: 89 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	742 bp
Genome contig ID	gi51511747f_61661200
PolyA signal sequence (TATAAA,-34)	+--------+--------+----*----+---- TTATAAAGCTTTTTCATAAAACTGGTTGTAGTTGC
Flanking genome sequence (139297 - 139346)	----+--------+--------+--------+--------+----* ACAGCTACTGGGAGGGCAGCCGGGGACACCTGAGCCGCCCGCTGTGCCCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	f	61761200	61800495	37	99.7	Perfect prediction

Primer_f	: CTCAATGTGCCAGGCTCTTCC
Primer_r	: GGAAAGCCACAAAGTCGATGA
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1088

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information