| HUGE |
Gene/Protein Characteristic Table for KIAA1071 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Mapping | |
| Product ID : | ORK04095 |
|---|---|
| Accession No. : | AB028994 |
| Description : | Angiomotin. |
| HUGO Gene Name : | angiomotin (AMOT) |
| Clone Name : | hj05664s2 [Vector Info] |
| Flexi ORF Clone : | pF1KA1071
![]() |
| Source : | Human adult brain |
| Note : | We replaced hj05664 and hj05664s1, former representative clones for KIAA1071 with hj05664s2. (2002/5/10,2003/4/2) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5667 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3639 bp Genome contig ID gi89161218r_111804812 PolyA signal sequence
(AATAAA,-25) +----*----+----*----+----*----+----
AGCTAGTTCCAATAAAGTTAAGCAGGTTTAAATCCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ACTTTGTGCCTATCTTTTCACTGACAATAAAGTTAGCTATTTTAAAATGC
Features of the protein sequence |
Description | |
|---|---|---|
Length: 675 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
|---|---|---|
| : X |
| : CCR | |
| : TAGGAAAGATACCCAGAGACC | |
| : CCGCATTATGAGGGTTTAGGC | |
| : 137 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |