HUGE |
Gene/Protein Characteristic Table for KIAA1071 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK04095 |
---|---|
Accession No. : | AB028994 |
Description : | Angiomotin. |
HUGO Gene Name : | angiomotin (AMOT) |
Clone Name : | hj05664s2 [Vector Info] |
Flexi ORF Clone : | pF1KA1071
![]() |
Source : | Human adult brain |
Note : | We replaced hj05664 and hj05664s1, former representative clones for KIAA1071 with hj05664s2. (2002/5/10,2003/4/2) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5667 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3639 bp Genome contig ID gi89161218r_111804812 PolyA signal sequence
(AATAAA,-25) +----*----+----*----+----*----+----
AGCTAGTTCCAATAAAGTTAAGCAGGTTTAAATCCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ACTTTGTGCCTATCTTTTCACTGACAATAAAGTTAGCTATTTTAAAATGC
Features of the protein sequence |
Description | |
---|---|---|
Length: 675 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR009114 | 74 | 92 | PR01807 | Angiomotin |
IPR009114 | 97 | 112 | PR01807 | Angiomotin | |
IPR009114 | 187 | 201 | PR01807 | Angiomotin | |
IPR009114 | 203 | 220 | PR01807 | Angiomotin | |
IPR009114 | 262 | 279 | PR01807 | Angiomotin | |
IPR009114 | 283 | 300 | PR01807 | Angiomotin | |
IPR009114 | 348 | 363 | PR01807 | Angiomotin |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
RH mapping information |
Description | |
---|---|---|
: X |
: CCR | |
: TAGGAAAGATACCCAGAGACC | |
: CCGCATTATGAGGGTTTAGGC | |
: 137 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |