HUGE

Gene/Protein Characteristic Table for KIAA1049

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07077
Accession No. :	AB028972
Description :	Transcription factor 25.
HUGO Gene Name :	transcription factor 25 (basic helix-loop-helix) (TCF25)
Clone Name :	hh02614a [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 1794 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 140 bp

Genome contig ID gi51511732f_88379756
PolyA signal sequence
(TATAAA,-18)
+----*----+----*----+----*----+----
TGGTCCACTGTTTCTCCTATAAATGTAAATGGGTC
Flanking genome sequence
(125533 - 125582)
----+----*----+----*----+----*----+----*----+----*
ACGCTCTGCCGTCCGCACCTTCTCCTTTCGCAGGCACTGAGCGCCGTCCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 f 88478514 88505287 16 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 550 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9BQ70	100.0	Transcription f...	Homo sapiens
XP_511180	99.6	NULP1 [Pan trog...	Pan troglodytes
EAW66677	99.8	NULP1, isoform ...	Homo sapiens
XP_001090795	96.2	similar to NULP...	Macaca mulatta
Q8R3L2	93.5	Transcription f...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006994 113 524 PF04910 Basic helix-loop-helix

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006994	113	524	PF04910	Basic helix-loop-helix

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGACCGAAAAGCCGTATGATG

Primer_r
: TAGGAGAAACAGTGGACCAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGACCGAAAAGCCGTATGATG
Primer_r	: TAGGAGAAACAGTGGACCAGG
PCR product length	: 111 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	140 bp
Genome contig ID	gi51511732f_88379756
PolyA signal sequence (TATAAA,-18)	+--------+--------+----*----+---- TGGTCCACTGTTTCTCCTATAAATGTAAATGGGTC
Flanking genome sequence (125533 - 125582)	----+--------+--------+--------+--------+----* ACGCTCTGCCGTCCGCACCTTCTCCTTTCGCAGGCACTGAGCGCCGTCCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	f	88478514	88505287	16	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1049

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information