HUGE |
Gene/Protein Characteristic Table for KIAA1034 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00718 |
---|---|
Accession No. : | AB028957 |
Description : | DNA-binding protein SATB2. |
HUGO Gene Name : | SATB homeobox 2 (SATB2) |
Clone Name : | fh00753 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1034
![]() |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4999 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2711 bp Genome contig ID gi89161199r_199742469 PolyA signal sequence
(AATAAA,-10) +----*----+----*----+----*----+----
TTTGGTTGTTAAAATAAACGCATTCAATAAATATGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ACTTTGTTTGTCAGTTATTTTACTGGGCATTATCTGCTTTCCCACTTAAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 r 199842469 200033446 11 99.4 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 761 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR003350 | 383 | 465 | PF02376 | Homeodomain protein CUT |
IPR003350 | 501 | 588 | PF02376 | Homeodomain protein CUT | |
IPR001356 | 643 | 700 | PF00046 | Homeobox | |
HMMSmart | IPR001356 | 642 | 705 | SM00389 | Homeobox |
ProfileScan | IPR003350 | 378 | 465 | PS51042 | Homeodomain protein CUT |
IPR003350 | 501 | 588 | PS51042 | Homeodomain protein CUT | |
IPR001356 | 640 | 701 | PS50071 | Homeobox |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: ATGGTTGCTGCTTCCTGATCT | |
: AAGATACCAAATGCGGATGCC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 2 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |