HUGE

Gene/Protein Characteristic Table for KIAA1006

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK02011
Accession No. :	AB023223
Description :	Syntaxin-binding protein 5-like.
HUGO Gene Name :	syntaxin binding protein 5-like (STXBP5L)
Clone Name :	hk10084 [Vector Info]
Flexi ORF Clone :	pF1KA1006
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4370 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 702 bp

Genome contig ID gi89161205f_122009773
PolyA signal sequence
(AGTAAA,-19)
+----*----+----*----+----*----+----
CAAATATTGCCAGTATAGTAAATTATTCCCAACAC
Flanking genome sequence
(611565 - 611614)
----+----*----+----*----+----*----+----*----+----*
AATCAGTTTCATTTCTATCACCTTCAGAATGGGTTGCTGTTTTTAGCACA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 f 122109773 122621336 28 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1221 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_516678	100.0	syntaxin bindin...	Pan troglodytes
EAW79517	100.0	hCG16779, isofo...	Homo sapiens
Q9Y2K9	100.0	Syntaxin-bindin...	Homo sapiens
XP_001070379	95.0	similar to Synt...	Rattus norvegicus
XP_001500511	97.7	syntaxin bindin...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051432	0.00033	23.9	KIAA1645

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000664 88 106 PR00962 Lethal(2) giant larvae protein

IPR001680 161 175 PR00320 WD40 repeat

IPR001680 259 273 PR00320 WD40 repeat

IPR000664 356 378 PR00962 Lethal(2) giant larvae protein

IPR000664 408 428 PR00962 Lethal(2) giant larvae protein

IPR000664 496 519 PR00962 Lethal(2) giant larvae protein

IPR001680 499 513 PR00320 WD40 repeat

IPR000664 679 703 PR00962 Lethal(2) giant larvae protein

HMMPfam IPR001680 287 313 PF00400 WD40 repeat

IPR013577 320 432 PF08366 Lethal giant larvae homologue 2

IPR001680 434 512 PF00400 WD40 repeat

HMMSmart IPR001680 94 133 SM00320 WD40 repeat

IPR001680 135 174 SM00320 WD40 repeat

IPR001680 233 272 SM00320 WD40 repeat

IPR001680 276 313 SM00320 WD40 repeat

IPR001680 433 512 SM00320 WD40 repeat

IPR001680 537 577 SM00320 WD40 repeat

ProfileScan IPR001680 142 183 PS50082 WD40 repeat

IPR001680 142 322 PS50294 WD40 repeat

IPR001680 281 322 PS50082 WD40 repeat

IPR001388 1156 1216 PS50892 Synaptobrevin

ScanRegExp IPR001680 161 175 PS00678 WD40 repeat

IPR001680 259 273 PS00678 WD40 repeat

IPR001680 499 513 PS00678 WD40 repeat

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000664	88	106	PR00962	Lethal(2) giant larvae protein
IPR001680	161	175	PR00320	WD40 repeat
IPR001680	259	273	PR00320	WD40 repeat
IPR000664	356	378	PR00962	Lethal(2) giant larvae protein
IPR000664	408	428	PR00962	Lethal(2) giant larvae protein
IPR000664	496	519	PR00962	Lethal(2) giant larvae protein
IPR001680	499	513	PR00320	WD40 repeat
IPR000664	679	703	PR00962	Lethal(2) giant larvae protein
HMMPfam	IPR001680	287	313	PF00400	WD40 repeat
IPR013577	320	432	PF08366	Lethal giant larvae homologue 2
IPR001680	434	512	PF00400	WD40 repeat
HMMSmart	IPR001680	94	133	SM00320	WD40 repeat
IPR001680	135	174	SM00320	WD40 repeat
IPR001680	233	272	SM00320	WD40 repeat
IPR001680	276	313	SM00320	WD40 repeat
IPR001680	433	512	SM00320	WD40 repeat
IPR001680	537	577	SM00320	WD40 repeat
ProfileScan	IPR001680	142	183	PS50082	WD40 repeat
IPR001680	142	322	PS50294	WD40 repeat
IPR001680	281	322	PS50082	WD40 repeat
IPR001388	1156	1216	PS50892	Synaptobrevin
ScanRegExp	IPR001680	161	175	PS00678	WD40 repeat
IPR001680	259	273	PS00678	WD40 repeat
IPR001680	499	513	PS00678	WD40 repeat

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACGGGGAGTCCTCTTGATTTG

Primer_r
: TGAGTGTGGCCCAATTGATAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ACGGGGAGTCCTCTTGATTTG
Primer_r	: TGAGTGTGGCCCAATTGATAG
PCR product length	: 176 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	702 bp
Genome contig ID	gi89161205f_122009773
PolyA signal sequence (AGTAAA,-19)	+--------+--------+----*----+---- CAAATATTGCCAGTATAGTAAATTATTCCCAACAC
Flanking genome sequence (611565 - 611614)	----+--------+--------+--------+--------+----* AATCAGTTTCATTTCTATCACCTTCAGAATGGGTTGCTGTTTTTAGCACA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	f	122109773	122621336	28	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1006

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information