| HUGE |
Gene/Protein Characteristic Table for KIAA0996 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00162 |
|---|---|
| Accession No. : | AB023213 |
| Description : | Zinc finger protein DZIP1. |
| HUGO Gene Name : | DAZ interacting protein 1 (DZIP1) |
| Clone Name : | hk07913 [Vector Info] |
| Flexi ORF Clone : | pF1KA0996
![]() |
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4502 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1117 bp Genome contig ID gi51511729r_94931372 PolyA signal sequence
(AGTAAA,-21) +----*----+----*----+----*----+----
TTGTCAACCTTTTCAGTAAAGCCCTCTGTTACATCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ACTGTGACTGTGGCTGTGTTATTAGAGATGAATTCTGAGTTAAATTTGTA
Chr f/r start end exon identity class ContigView(URL based/DAS) 13 r 95031372 95094945 22 100.0 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 869 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : GTTTAAGACTTCCGCTGCTGC | |
| : GCCTACGATACGACAGCATAC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 13 |
| : GeneBridge 4 | |
| : GTTTAAGACTTCCGCTGCTGC | |
| : GCCTACGATACGACAGCATAC | |
| : 202 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |