HUGE

Gene/Protein Characteristic Table for KIAA0994

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06263
Accession No. :	AB023211
Description :	Protein-arginine deiminase type-2.
HUGO Gene Name :	peptidyl arginine deiminase, type II (PADI2)
Clone Name :	hk07627 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4343 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2281 bp

Genome contig ID gi89161185r_17165844
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
AAAGAACAATGAAATAAATGGTCCAAGGGGAAGTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATATGGCTGTTGGTGTGATGTTCTTTGCTGCTTCATAGACACGGCCTGGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 17265844 17318517 16 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 686 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_513113	100.0	peptidyl argini...	Pan troglodytes
XP_001099772	98.3	peptidyl argini...	Macaca mulatta
Q9Y2J8	100.0	Protein-arginin...	Homo sapiens
BAA82557	99.8	peptidylarginin...	Homo sapiens
BAD16624	93.2	peptidylarginin...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013732 22 135 PF08526 Protein-arginine deiminase (PAD) N-terminal

IPR013733 137 295 PF08527 Protein-arginine deiminase (PAD) central region

IPR013530 300 686 PF03068 Protein-arginine deiminase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013732	22	135	PF08526	Protein-arginine deiminase (PAD) N-terminal
IPR013733	137	295	PF08527	Protein-arginine deiminase (PAD) central region
IPR013530	300	686	PF03068	Protein-arginine deiminase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTTCCTGCTTCCACCTTGATG

Primer_r
: CATTGTTCTTTAGTCGAGCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GTTCCTGCTTCCACCTTGATG
Primer_r	: CATTGTTCTTTAGTCGAGCTC
PCR product length	: 153 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2281 bp
Genome contig ID	gi89161185r_17165844
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AAAGAACAATGAAATAAATGGTCCAAGGGGAAGTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATATGGCTGTTGGTGTGATGTTCTTTGCTGCTTCATAGACACGGCCTGGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	17265844	17318517	16	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0994

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information