HUGE

Gene/Protein Characteristic Table for KIAA0961

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00698
Accession No. :	AB023178
Description :	Zinc finger protein 30 homolog.
HUGO Gene Name :	zinc finger protein 30 homolog (mouse) (ZFP30)
Clone Name :	hj05830 [Vector Info]
Flexi ORF Clone :	pF1KSDA0961
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4612 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2494 bp

Genome contig ID gi42406306r_42715546
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TCAGCGCTGGCATAAACAATAAAAAGTAGACTTGG
Flanking genome sequence
(222608 - 222559)
----+----*----+----*----+----*----+----*----+----*
CTTCAGTATTTAAGGCCATAGATTTTGCTTTGAGCACAGATTTTGCTGTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 r 42809130 42838153 7 98.1 Terminal No-hit

Features of the protein sequence	Description

Length: 530 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9Y2G7	0	100.0	Zinc finger pro...	Homo sapiens
XP_001165619	0	99.8	zinc finger pro...	Pan troglodytes
XP_001165552	0	99.6	zinc finger pro...	Pan troglodytes
Q9BE27	0	98.1	Zinc finger pro...	Macaca fascicularis
XP_001493771	2.6e-196	86.0	similar to zinc...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB075828	8.4e-98	76.8	KIAA1948
AB046779	1.2e-86	69.4	KIAA1559
AB046831	7.4e-66	44.6	KIAA1611
AB037770	3.1e-65	56.1	KIAA1349
D31763	6.3e-64	53.8	KIAA0065

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR007087 169 192 PD000003 Zinc finger

IPR007087 197 220 PD000003 Zinc finger

IPR007087 225 247 PD000003 Zinc finger

IPR007087 253 276 PD000003 Zinc finger

IPR007087 281 301 PD000003 Zinc finger

IPR007087 309 332 PD000003 Zinc finger

IPR007087 337 360 PD000003 Zinc finger

IPR007087 365 388 PD000003 Zinc finger

IPR007087 393 415 PD000003 Zinc finger

IPR007087 421 443 PD000003 Zinc finger

IPR007087 449 472 PD000003 Zinc finger

IPR007087 477 500 PD000003 Zinc finger

IPR007087 505 527 PD000003 Zinc finger

HMMPfam IPR001909 17 57 PF01352 KRAB box

IPR007087 169 191 PF00096 Zinc finger

IPR007087 197 219 PF00096 Zinc finger

IPR007087 225 247 PF00096 Zinc finger

IPR007087 253 275 PF00096 Zinc finger

IPR007087 281 308 PF00096 Zinc finger

IPR007087 337 359 PF00096 Zinc finger

IPR007087 365 387 PF00096 Zinc finger

IPR007087 393 415 PF00096 Zinc finger

IPR007087 421 443 PF00096 Zinc finger

IPR007087 449 471 PF00096 Zinc finger

IPR007087 477 499 PF00096 Zinc finger

IPR007087 505 527 PF00096 Zinc finger

HMMSmart IPR001909 17 78 SM00349 KRAB box

IPR015880 169 191 SM00355 Zinc finger

IPR015880 197 219 SM00355 Zinc finger

IPR015880 225 247 SM00355 Zinc finger

IPR015880 253 275 SM00355 Zinc finger

IPR015880 281 301 SM00355 Zinc finger

IPR015880 309 331 SM00355 Zinc finger

IPR015880 337 359 SM00355 Zinc finger

IPR015880 365 387 SM00355 Zinc finger

IPR015880 393 415 SM00355 Zinc finger

IPR015880 421 443 SM00355 Zinc finger

IPR015880 449 471 SM00355 Zinc finger

IPR015880 477 499 SM00355 Zinc finger

IPR015880 505 527 SM00355 Zinc finger

ProfileScan IPR001909 17 89 PS50805 KRAB box

IPR007087 169 196 PS50157 Zinc finger

IPR007087 197 224 PS50157 Zinc finger

IPR007087 225 252 PS50157 Zinc finger

IPR007087 253 280 PS50157 Zinc finger

IPR007087 281 308 PS50157 Zinc finger

IPR007087 309 336 PS50157 Zinc finger

IPR007087 337 364 PS50157 Zinc finger

IPR007087 365 392 PS50157 Zinc finger

IPR007087 393 420 PS50157 Zinc finger

IPR007087 421 448 PS50157 Zinc finger

IPR007087 449 476 PS50157 Zinc finger

IPR007087 477 504 PS50157 Zinc finger

IPR007087 505 530 PS50157 Zinc finger

ScanRegExp IPR007087 171 191 PS00028 Zinc finger

IPR007087 199 219 PS00028 Zinc finger

IPR007087 227 247 PS00028 Zinc finger

IPR007087 255 275 PS00028 Zinc finger

IPR007087 311 331 PS00028 Zinc finger

IPR007087 339 359 PS00028 Zinc finger

IPR007087 367 387 PS00028 Zinc finger

IPR007087 395 415 PS00028 Zinc finger

IPR007087 423 443 PS00028 Zinc finger

IPR007087 451 471 PS00028 Zinc finger

IPR007087 479 499 PS00028 Zinc finger

IPR007087 507 527 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	169	192	PD000003	Zinc finger
IPR007087	197	220	PD000003	Zinc finger
IPR007087	225	247	PD000003	Zinc finger
IPR007087	253	276	PD000003	Zinc finger
IPR007087	281	301	PD000003	Zinc finger
IPR007087	309	332	PD000003	Zinc finger
IPR007087	337	360	PD000003	Zinc finger
IPR007087	365	388	PD000003	Zinc finger
IPR007087	393	415	PD000003	Zinc finger
IPR007087	421	443	PD000003	Zinc finger
IPR007087	449	472	PD000003	Zinc finger
IPR007087	477	500	PD000003	Zinc finger
IPR007087	505	527	PD000003	Zinc finger
HMMPfam	IPR001909	17	57	PF01352	KRAB box
IPR007087	169	191	PF00096	Zinc finger
IPR007087	197	219	PF00096	Zinc finger
IPR007087	225	247	PF00096	Zinc finger
IPR007087	253	275	PF00096	Zinc finger
IPR007087	281	308	PF00096	Zinc finger
IPR007087	337	359	PF00096	Zinc finger
IPR007087	365	387	PF00096	Zinc finger
IPR007087	393	415	PF00096	Zinc finger
IPR007087	421	443	PF00096	Zinc finger
IPR007087	449	471	PF00096	Zinc finger
IPR007087	477	499	PF00096	Zinc finger
IPR007087	505	527	PF00096	Zinc finger
HMMSmart	IPR001909	17	78	SM00349	KRAB box
IPR015880	169	191	SM00355	Zinc finger
IPR015880	197	219	SM00355	Zinc finger
IPR015880	225	247	SM00355	Zinc finger
IPR015880	253	275	SM00355	Zinc finger
IPR015880	281	301	SM00355	Zinc finger
IPR015880	309	331	SM00355	Zinc finger
IPR015880	337	359	SM00355	Zinc finger
IPR015880	365	387	SM00355	Zinc finger
IPR015880	393	415	SM00355	Zinc finger
IPR015880	421	443	SM00355	Zinc finger
IPR015880	449	471	SM00355	Zinc finger
IPR015880	477	499	SM00355	Zinc finger
IPR015880	505	527	SM00355	Zinc finger
ProfileScan	IPR001909	17	89	PS50805	KRAB box
IPR007087	169	196	PS50157	Zinc finger
IPR007087	197	224	PS50157	Zinc finger
IPR007087	225	252	PS50157	Zinc finger
IPR007087	253	280	PS50157	Zinc finger
IPR007087	281	308	PS50157	Zinc finger
IPR007087	309	336	PS50157	Zinc finger
IPR007087	337	364	PS50157	Zinc finger
IPR007087	365	392	PS50157	Zinc finger
IPR007087	393	420	PS50157	Zinc finger
IPR007087	421	448	PS50157	Zinc finger
IPR007087	449	476	PS50157	Zinc finger
IPR007087	477	504	PS50157	Zinc finger
IPR007087	505	530	PS50157	Zinc finger
ScanRegExp	IPR007087	171	191	PS00028	Zinc finger
IPR007087	199	219	PS00028	Zinc finger
IPR007087	227	247	PS00028	Zinc finger
IPR007087	255	275	PS00028	Zinc finger
IPR007087	311	331	PS00028	Zinc finger
IPR007087	339	359	PS00028	Zinc finger
IPR007087	367	387	PS00028	Zinc finger
IPR007087	395	415	PS00028	Zinc finger
IPR007087	423	443	PS00028	Zinc finger
IPR007087	451	471	PS00028	Zinc finger
IPR007087	479	499	PS00028	Zinc finger
IPR007087	507	527	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCCCTTTTGCTTCATGCTCAC

Primer_r
: CACAGATGGAAGAATATGGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TCCCTTTTGCTTCATGCTCAC
Primer_r	: CACAGATGGAAGAATATGGAG
PCR product length	: 206 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2494 bp
Genome contig ID	gi42406306r_42715546
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TCAGCGCTGGCATAAACAATAAAAAGTAGACTTGG
Flanking genome sequence (222608 - 222559)	----+--------+--------+--------+--------+----* CTTCAGTATTTAAGGCCATAGATTTTGCTTTGAGCACAGATTTTGCTGTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	r	42809130	42838153	7	98.1	Terminal No-hit

Gene/Protein Characteristic Table for KIAA0961

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information