HUGE

Gene/Protein Characteristic Table for KIAA0942

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06506
Accession No. :	AB023159
Description :	PH and SEC7 domain-containing protein 3.
HUGO Gene Name :	pleckstrin and Sec7 domain containing 3 (PSD3)
Clone Name :	hh04979s1 [Vector Info]
Flexi ORF Clone :	pF1KA0942
Source :	Human adult brain
Note :	We replaced hh04979, former representative clones for KIAA0942 with hh04979s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6670 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 5038 bp

Genome contig ID gi51511724r_18332500
PolyA signal sequence
(AATACA,-7)
+----*----+----*----+----*----+----
CAAGGGCATAGCTCCCTGTAATTTGGGAAATACAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAGAAAAGAAAAAAAAAAAAAAAGGCAGCCTGTGCAGTCTTAGTAACTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 r 18432500 18710666 13 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 537 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG72691	4.6e-210	100.0	pleckstrin and ...	synthetic construct
XP_001147696	2e-209	99.6	ADP-ribosylatio...	Pan troglodytes
XP_001147547	8.5e-204	96.6	similar to guan...	Pan troglodytes
AAH75044	9.1e-204	96.9	PSD3 protein [H...	Homo sapiens
EAW63782	1.5e-203	96.9	pleckstrin and ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB095931	5.6e-96	59.0	KIAA2011
D87435	2.2e-12	26.1	KIAA0248
AB018306	1.7e-11	30.8	KIAA0763
AB029033	3.3e-11	34.2	KIAA1110
AB011094	1.8e-10	30.5	KIAA0522

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001605 277 296 PR00683 Spectrin/pleckstrin-like

IPR001605 342 359 PR00683 Spectrin/pleckstrin-like

IPR001605 362 380 PR00683 Spectrin/pleckstrin-like

HMMPfam IPR000904 40 225 PF01369 SEC7-like

IPR001849 275 387 PF00169 Pleckstrin-like

HMMSmart IPR000904 38 225 SM00222 SEC7-like

IPR001849 275 389 SM00233 Pleckstrin-like

ProfileScan IPR000904 38 223 PS50190 SEC7-like

IPR001849 274 387 PS50003 Pleckstrin-like

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001605	277	296	PR00683	Spectrin/pleckstrin-like
IPR001605	342	359	PR00683	Spectrin/pleckstrin-like
IPR001605	362	380	PR00683	Spectrin/pleckstrin-like
HMMPfam	IPR000904	40	225	PF01369	SEC7-like
IPR001849	275	387	PF00169	Pleckstrin-like
HMMSmart	IPR000904	38	225	SM00222	SEC7-like
IPR001849	275	389	SM00233	Pleckstrin-like
ProfileScan	IPR000904	38	223	PS50190	SEC7-like
IPR001849	274	387	PS50003	Pleckstrin-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATGAAAAGCAAGTACAACCTC

Primer_r
: CACTGCAAAAGATTCACAAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 8

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	5038 bp
Genome contig ID	gi51511724r_18332500
PolyA signal sequence (AATACA,-7)	+--------+--------+----*----+---- CAAGGGCATAGCTCCCTGTAATTTGGGAAATACAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGAAAAGAAAAAAAAAAAAAAAGGCAGCCTGTGCAGTCTTAGTAACTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	r	18432500	18710666	13	99.2	Perfect prediction

Primer_f	: ATGAAAAGCAAGTACAACCTC
Primer_r	: CACTGCAAAAGATTCACAAGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0942

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information