HUGE

Gene/Protein Characteristic Table for KIAA0915

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00681
Accession No. :	AB020722
Description :	Rho guanine nucleotide exchange factor 15.
HUGO Gene Name :	Rho guanine nucleotide exchange factor (GEF) 15 (ARHGEF15)
Clone Name :	hk06275s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0915
Source :	Human adult brain
Note :	We replaced hk06275, former representative clones for KIAA0915 with hk06275s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4114 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1517 bp

Genome contig ID gi51511734f_8056033
PolyA signal sequence
(AGTAAA,-21)
+----*----+----*----+----*----+----
TGTGGGGAACCCTCAGTAAATAGTGGTGCATTTGT
Flanking genome sequence
(110522 - 110571)
----+----*----+----*----+----*----+----*----+----*
ATTGAGGCTCTCTGAGGAAGTGTGTGCTTATAGGAGCAGTGGTCTCCAAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 f 8154885 8166553 16 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 846 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09898	100.0	Rho guanine nuc...	synthetic construct
EAW90060	99.9	Rho guanine nuc...	Homo sapiens
O94989	99.9	Rho guanine nuc...	Homo sapiens
AAH36749	99.8	Rho guanine nuc...	Homo sapiens
XP_001166994	99.2	Rho guanine exc...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000219 426 605 PF00621 DH

HMMSmart IPR000219 426 605 SM00325 DH

ProfileScan IPR000219 422 606 PS50010 DH

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000219	426	605	PF00621	DH
HMMSmart	IPR000219	426	605	SM00325	DH
ProfileScan	IPR000219	422	606	PS50010	DH

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AACTTGCCCAGGACTGACACT

Primer_r
: CCACTATTTACTGAGGGTTCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AACTTGCCCAGGACTGACACT
Primer_r	: CCACTATTTACTGAGGGTTCC
PCR product length	: 157 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1517 bp
Genome contig ID	gi51511734f_8056033
PolyA signal sequence (AGTAAA,-21)	+--------+--------+----*----+---- TGTGGGGAACCCTCAGTAAATAGTGGTGCATTTGT
Flanking genome sequence (110522 - 110571)	----+--------+--------+--------+--------+----* ATTGAGGCTCTCTGAGGAAGTGTGTGCTTATAGGAGCAGTGGTCTCCAAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	f	8154885	8166553	16	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA0915

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information