| HUGE |
Gene/Protein Characteristic Table for KIAA0901 |
|
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK01133 |
|---|---|
| Accession No. : | AB020708 |
| Description : | Histone deacetylase 6. |
| HUGO Gene Name : | histone deacetylase 6 (HDAC6) |
| Clone Name : | hk09716 [Vector Info] |
| Flexi ORF Clone : | pF1KA0901
![]() |
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4078 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 358 bp Genome contig ID gi89161218f_48445452 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
GGCAAGGTTGCATATGTAATAAAGTACAAGCTGTTFlanking genome sequence
(122874 - 122923) ----+----*----+----*----+----*----+----*----+----*
AAAAAACCTGGAGAAAGCTTTTTGACTTTGAGCAGGTGGAGAACCCCACA
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1233 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : CCCATCCTGAATATCCTTTGC | |
| : TTCTGGGCTGGAGTAGTGGTG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : X |
| : UniGene | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |