HUGE

Gene/Protein Characteristic Table for KIAA0871

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00666
Accession No. :	AB020678
Description :	Protein RUFY3.
HUGO Gene Name :	RUN and FYVE domain containing 3 (RUFY3)
Clone Name :	hk06991 [Vector Info]
Flexi ORF Clone :	pF1KSDA0871
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4207 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2259 bp

Genome contig ID gi89161207f_71706618
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
AAACTGTAGTACTAGAATAAAAAAAATGGAAAATC
Flanking genome sequence
(171521 - 171570)
----+----*----+----*----+----*----+----*----+----*
AGCTTTTCCTCTGCCTGGTTCACCTTCATCTTACTTTTCTTTAGAATTTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 f 71806618 71878137 13 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 471 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q7L099	4e-160	100.0	Protein RUFY3; ...	Homo sapiens
Q5R4V2	1.3e-159	99.8	Protein RUFY3.	Pongo abelii
ABZ92309	1.7e-159	99.8	RUN and FYVE do...	synthetic construct
XP_532400	1.9e-159	99.4	similar to rap2...	Canis lupus fam...
Q5FVJ0	6e-159	99.1	Protein RUFY3; ...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040970	3e-39	62.9	KIAA1537

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004012 105 229 PF02759 RUN

HMMSmart IPR004012 165 227 SM00593 RUN

ProfileScan IPR004012 97 229 PS50826 RUN

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004012	105	229	PF02759	RUN
HMMSmart	IPR004012	165	227	SM00593	RUN
ProfileScan	IPR004012	97	229	PS50826	RUN

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGAAGGAGTGATCAAATACCG

Primer_r
: AAGATGTGTGACTAAGTGGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2259 bp
Genome contig ID	gi89161207f_71706618
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AAACTGTAGTACTAGAATAAAAAAAATGGAAAATC
Flanking genome sequence (171521 - 171570)	----+--------+--------+--------+--------+----* AGCTTTTCCTCTGCCTGGTTCACCTTCATCTTACTTTTCTTTAGAATTTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	f	71806618	71878137	13	99.3	Perfect prediction

Primer_f	: GGAAGGAGTGATCAAATACCG
Primer_r	: AAGATGTGTGACTAAGTGGAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0871

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information