| HUGE |
Gene/Protein Characteristic Table for KIAA0853 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK07403 |
|---|---|
| Accession No. : | AB020660 |
| Description : | Zinc finger CCCH domain-containing protein 13. |
| HUGO Gene Name : | |
| Clone Name : | hk06136 [Vector Info] |
| Flexi ORF Clone : | pF1KA0853
![]() |
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4363 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 1457 bp Genome contig ID gi51511729r_45327819 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
TTACTAAGTGTTTTGAATAAAGAAAAAAAAAATGTFlanking genome sequence
(99987 - 99938) ----+----*----+----*----+----*----+----*----+----*
ATGACCTCAGAGAATGAATACCCTTCAGGAAGCCACTTCCTGATTTTAGT
Chr f/r start end exon identity class ContigView(URL based/DAS) 13 r 45427806 45447783 8 99.8 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 967 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
| Motif_DB | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| None | - | - | - | - | - |
| Method | No. | N terminal | transmembrane region | C terminal | type | length |
|---|---|---|---|---|---|---|
| - | - | - | - | - | - | - |
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : GGAAAATGGTTGTCACTGCTC | |
| : ACATACCACGCCAGCTAGACC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 13 |
| : GeneBridge 4 | |
| : GATCATCCATACAGAACCAAC | |
| : ACATACCACGCCAGCTAGACC | |
| : 129 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |