| HUGE |
Gene/Protein Characteristic Table for KIAA0849 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK01610 |
|---|---|
| Accession No. : | AB020656 |
| Description : | Probable ubiquitin carboxyl-terminal hydrolase CYLD. |
| HUGO Gene Name : | cylindromatosis (turban tumor syndrome) (CYLD) |
| Clone Name : | fh04363 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0849
|
| Source : | Human fetal brain |
| Note : | We replaced hk05904, former representative clones for KIAA0849 with fh04363. (2001/5/29) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5414 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Features of the protein sequence |
Description | |
|---|---|---|
Length: 960 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|
Experimental conditions
| : TTATCGAAATGTTAGCAGCAG | |
| : TCATCTATGGTCCTGGTCTAC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 16 |
| : GeneBridge 4 | |
| : TTATCGAAATGTTAGCAGCAG | |
| : TCATCTATGGTCCTGGTCTAC | |
| : 130 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
