| HUGE |
Gene/Protein Characteristic Table for KIAA0842 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK01609 |
|---|---|
| Accession No. : | AB020649 |
| Description : | pleckstrin homology domain containing, family M (with RUN domain) member 2. |
| HUGO Gene Name : | pleckstrin homology domain containing, family M (with RUN domain) member 2 (PLEKHM2) |
| Clone Name : | hk05077 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0842
![]() |
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 3896 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 833 bp Genome contig ID gi89161185f_15783638 PolyA signal sequence
(AATAAA,-25) +----*----+----*----+----*----+----
TGTTTTTTAAAATAAAATAGACATGTTATATTGCCFlanking genome sequence
(150213 - 150262) ----+----*----+----*----+----*----+----*----+----*
AAGGCTTGTCACTGGCCCTTTTTGAGCAGGGTAGGGGAAGGGAGCTCTCC
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 15883638 15933849 20 100.0 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1020 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : TGTAGCACCGAGGAGCAAAGG | |
| : GGCTCTTGACGAAACTCTAGG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 1 |
| : GeneBridge 4 | |
| : TGTAGCACCGAGGAGCAAAGG | |
| : GGCTCTTGACGAAACTCTAGG | |
| : 140 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |