HUGE

Gene/Protein Characteristic Table for KIAA0840

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01999
Accession No. :	AB020647
Description :	F-box/LRR-repeat protein 7.
HUGO Gene Name :	F-box and leucine-rich repeat protein 7 (FBXL7)
Clone Name :	hk04921s1 [Vector Info]
Flexi ORF Clone :	pF1KA0840
Source :	Human adult brain
Note :	We replaced hk04921, former representative clones for KIAA0840 with hk04921s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4562 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2605 bp

Genome contig ID gi51511721f_15453305
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TAATTTACTACCAAGAAATAAAGCAATATGTTCGT
Flanking genome sequence
(539597 - 539646)
----+----*----+----*----+----*----+----*----+----*
AATCAGCCTCAGCTTCATTTTTAATAACCTTTCCAGAGGAGAGTGCTGTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 f 15553305 15992900 4 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 523 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9UJT9	1.6e-193	100.0	F-box/LRR-repea...	Homo sapiens
EDL82624	4.9e-191	98.6	F-box and leuci...	Rattus norvegicus
Q5BJ29	6.5e-191	98.4	F-box/LRR-repea...	Mus musculus
EDL08903	1.5e-190	98.2	F-box and leuci...	Mus musculus
AAF04514	3.4e-190	100.0	F-box protein F...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001810 144 191 PF00646 Cyclin-like F-box

HMMSmart IPR001810 149 189 SM00256 Cyclin-like F-box

IPR006553 217 242 SM00367 Leucine-rich repeat

IPR006553 243 268 SM00367 Leucine-rich repeat

IPR006553 269 294 SM00367 Leucine-rich repeat

IPR006553 303 328 SM00367 Leucine-rich repeat

IPR006553 329 354 SM00367 Leucine-rich repeat

IPR006553 355 380 SM00367 Leucine-rich repeat

IPR006553 381 406 SM00367 Leucine-rich repeat

IPR006553 407 432 SM00367 Leucine-rich repeat

IPR006553 433 458 SM00367 Leucine-rich repeat

IPR006553 459 484 SM00367 Leucine-rich repeat

IPR006553 485 509 SM00367 Leucine-rich repeat

ProfileScan IPR001810 143 189 PS50181 Cyclin-like F-box

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001810	144	191	PF00646	Cyclin-like F-box
HMMSmart	IPR001810	149	189	SM00256	Cyclin-like F-box
IPR006553	217	242	SM00367	Leucine-rich repeat
IPR006553	243	268	SM00367	Leucine-rich repeat
IPR006553	269	294	SM00367	Leucine-rich repeat
IPR006553	303	328	SM00367	Leucine-rich repeat
IPR006553	329	354	SM00367	Leucine-rich repeat
IPR006553	355	380	SM00367	Leucine-rich repeat
IPR006553	381	406	SM00367	Leucine-rich repeat
IPR006553	407	432	SM00367	Leucine-rich repeat
IPR006553	433	458	SM00367	Leucine-rich repeat
IPR006553	459	484	SM00367	Leucine-rich repeat
IPR006553	485	509	SM00367	Leucine-rich repeat
ProfileScan	IPR001810	143	189	PS50181	Cyclin-like F-box

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTGTTCATCCATTCTGTTCTC

Primer_r
: TAGCAGAGCCAGGAAGGAAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2605 bp
Genome contig ID	gi51511721f_15453305
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TAATTTACTACCAAGAAATAAAGCAATATGTTCGT
Flanking genome sequence (539597 - 539646)	----+--------+--------+--------+--------+----* AATCAGCCTCAGCTTCATTTTTAATAACCTTTCCAGAGGAGAGTGCTGTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	f	15553305	15992900	4	100.0	Perfect prediction

Primer_f	: CTGTTCATCCATTCTGTTCTC
Primer_r	: TAGCAGAGCCAGGAAGGAAGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0840

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information