HUGE

Gene/Protein Characteristic Table for KIAA0788

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04188
Accession No. :	AB018331
Description :	U5 small nuclear ribonucleoprotein 200 kDa helicase.
HUGO Gene Name :	small nuclear ribonucleoprotein 200kDa (U5) (SNRNP200)
Clone Name :	hk05526s2 [Vector Info]
Source :	Human adult brain
Note :	We replaced hk05526, former representative clones for KIAA0788 with hk05526s2. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6754 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 673 bp

Genome contig ID gi89161199r_96203804
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TGTGACCCAGTCTTAATAAACAGGTTTTCTAATCC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGATCTTCCGACTGTCTTCAAATTCTTACCTTCTGTTCTTTAGATTAAAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 96303804 96332674 43 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 2026 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O75643	100.0	U5 small nuclea...	Homo sapiens
AAS78571	100.0	200 kDa U5 snRN...	Homo sapiens
XP_001492729	99.9	activating sign...	Equus caballus
AAH63261	99.7	Activating sign...	Mus musculus
EDL28177	99.7	activating sign...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D29641	1.7e-07	25.3	KIAA0052
AB018344	0.00011	23.4	KIAA0801

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR011545 372 551 PF00270 DNA/RNA helicase

IPR001650 664 750 PF00271 DNA/RNA helicase

IPR004179 871 1176 PF02889 Sec63

IPR011545 1219 1390 PF00270 DNA/RNA helicase

IPR001650 1502 1585 PF00271 DNA/RNA helicase

IPR004179 1702 2014 PF02889 Sec63

HMMSmart IPR014001 367 580 SM00487 DEAD-like helicases

IPR001650 658 750 SM00490 DNA/RNA helicase

IPR004179 868 1177 SM00611 Sec63

IPR014001 1214 1418 SM00487 DEAD-like helicases

IPR001650 1497 1585 SM00490 DNA/RNA helicase

IPR004179 1699 2015 SM00611 Sec63

ProfileScan IPR014021 380 563 PS51192 Helicase

IPR001650 574 811 PS51194 DNA/RNA helicase

IPR014021 1227 1402 PS51192 Helicase

IPR001650 1435 1643 PS51194 DNA/RNA helicase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011545	372	551	PF00270	DNA/RNA helicase
IPR001650	664	750	PF00271	DNA/RNA helicase
IPR004179	871	1176	PF02889	Sec63
IPR011545	1219	1390	PF00270	DNA/RNA helicase
IPR001650	1502	1585	PF00271	DNA/RNA helicase
IPR004179	1702	2014	PF02889	Sec63
HMMSmart	IPR014001	367	580	SM00487	DEAD-like helicases
IPR001650	658	750	SM00490	DNA/RNA helicase
IPR004179	868	1177	SM00611	Sec63
IPR014001	1214	1418	SM00487	DEAD-like helicases
IPR001650	1497	1585	SM00490	DNA/RNA helicase
IPR004179	1699	2015	SM00611	Sec63
ProfileScan	IPR014021	380	563	PS51192	Helicase
IPR001650	574	811	PS51194	DNA/RNA helicase
IPR014021	1227	1402	PS51192	Helicase
IPR001650	1435	1643	PS51194	DNA/RNA helicase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AAGTCCAATAGCCTCATCTCC

Primer_r
: ATCTGAATCACTGTCTGTCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	673 bp
Genome contig ID	gi89161199r_96203804
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TGTGACCCAGTCTTAATAAACAGGTTTTCTAATCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGATCTTCCGACTGTCTTCAAATTCTTACCTTCTGTTCTTTAGATTAAAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	96303804	96332674	43	100.0	Perfect prediction

Primer_f	: AAGTCCAATAGCCTCATCTCC
Primer_r	: ATCTGAATCACTGTCTGTCTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0788

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information