HUGE

Gene/Protein Characteristic Table for KIAA0052

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	D29641
Description :	Superkiller viralicidic activity 2-like 2.
HUGO Gene Name :
Clone Name :	ha01319 [Vector Info]
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 3353 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 211 bp

Genome contig ID gi51511721f_54539587
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
TTTTTTTAATAAAAATGTATACAGGTGGGGCACTG
Flanking genome sequence
(216983 - 217032)
----+----*----+----*----+----*----+----*----+----*
TTTTGGTGGAAGGCTTGGAGTTTTTTTAATGAGTTTAGAGCTATTAGATA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 f 54639587 54756568 27 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1046 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH65258	100.0	SKIV2L2 protein...	Homo sapiens
P42285	100.0	Superkiller vir...	Homo sapiens
XP_001145794	99.8	superkiller vir...	Pan troglodytes
CAE45877	99.8	hypothetical pr...	Homo sapiens
BAF84338	99.8	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018331	3.8e-08	25.5	KIAA0788

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR011545 145 296 PF00270 DNA/RNA helicase

IPR001650 448 532 PF00271 DNA/RNA helicase

IPR012961 858 1046 PF08148 DSH

HMMSmart IPR014001 140 323 SM00487 DEAD-like helicases

IPR001650 443 532 SM00490 DNA/RNA helicase

ProfileScan IPR014021 152 308 PS51192 Helicase

IPR001650 409 581 PS51194 DNA/RNA helicase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011545	145	296	PF00270	DNA/RNA helicase
IPR001650	448	532	PF00271	DNA/RNA helicase
IPR012961	858	1046	PF08148	DSH
HMMSmart	IPR014001	140	323	SM00487	DEAD-like helicases
IPR001650	443	532	SM00490	DNA/RNA helicase
ProfileScan	IPR014021	152	308	PS51192	Helicase
IPR001650	409	581	PS51194	DNA/RNA helicase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: ACGGCATCCCCTTATTAGACC
Primer_r	: CCACTCGTCCTTTCATCTCTA
PCR product length	: 316 (3.5k) bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	211 bp
Genome contig ID	gi51511721f_54539587
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- TTTTTTTAATAAAAATGTATACAGGTGGGGCACTG
Flanking genome sequence (216983 - 217032)	----+--------+--------+--------+--------+----* TTTTGGTGGAAGGCTTGGAGTTTTTTTAATGAGTTTAGAGCTATTAGATA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	f	54639587	54756568	27	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0052

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information