HUGE

Gene/Protein Characteristic Table for KIAA0785

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00638
Accession No. :	AB018328
Description :	Zinc finger BED domain-containing protein 1.
HUGO Gene Name :	zinc finger, BED-type containing 1 (ZBED1)
Clone Name :	hk05482 [Vector Info]
Flexi ORF Clone :	pF1KSDA0785
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4485 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2199 bp

Genome contig ID gi89161218r_2314477
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
AAGTTGGACTGTTGTTCAATAAACCAGAGCAATGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTAGCTCCTCATTCATTTGTCTGCCGCGTGTCCGTCTGGACTGCAGTTT

Features of the protein sequence	Description

Length: 706 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O96006	0	100.0	Zinc finger BED...	Homo sapiens
AAH15030	0	99.9	ZBED1 protein [...	Homo sapiens
XP_548835	0	89.1	similar to Zinc...	Canis lupus fam...
XP_001916820	0	86.0	similar to Zinc...	Equus caballus
CAJ83469	1.5e-201	76.4	zinc finger, BE...	Xenopus (Silura...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014537	4e-25	25.0	KIAA0637

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003656 35 84 PF02892 Zinc finger

IPR008906 583 663 PF05699 HAT dimerisation

HMMSmart IPR003656 32 86 SM00614 Zinc finger

ProfileScan IPR003656 32 90 PS50808 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003656	35	84	PF02892	Zinc finger
IPR008906	583	663	PF05699	HAT dimerisation
HMMSmart	IPR003656	32	86	SM00614	Zinc finger
ProfileScan	IPR003656	32	90	PS50808	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATATTGCTTGGATTCTACGTG

Primer_r
: GGACGTAAGGATAACATTCTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ATATTGCTTGGATTCTACGTG
Primer_r	: GGACGTAAGGATAACATTCTG
PCR product length	: 219 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2199 bp
Genome contig ID	gi89161218r_2314477
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AAGTTGGACTGTTGTTCAATAAACCAGAGCAATGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTAGCTCCTCATTCATTTGTCTGCCGCGTGTCCGTCTGGACTGCAGTTT

Gene/Protein Characteristic Table for KIAA0785

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information