HUGE

Gene/Protein Characteristic Table for KIAA0744

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00124
Accession No. :	AB018287
Description :	Histone deacetylase 9.
HUGO Gene Name :	histone deacetylase 9 (HDAC9)
Clone Name :	hk04110 [Vector Info]
Flexi ORF Clone :	pF1KA0744
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4238 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 619 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001104526	3.3e-189	99.0	similar to hist...	Macaca mulatta
ACE86818	4.7e-188	99.2	histone deacety...	synthetic construct
XP_862756	5.4e-187	98.8	similar to hist...	Canis lupus fam...
EAW93702	3.8e-185	100.0	histone deacety...	Homo sapiens
EAW93709	2.4e-184	99.5	histone deacety...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB006626	2.1e-45	51.1	KIAA0288
AB011172	1.8e-35	50.5	KIAA0600

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TAGGGAAATTGTTACGGAAGC

Primer_r
: ACTACACCTTGAAATACCTCG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TAGGGAAATTGTTACGGAAGC
Primer_r	: ACTACACCTTGAAATACCTCG
PCR product length	: 220 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0744

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information