HUGE

Gene/Protein Characteristic Table for KIAA0738

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01604
Accession No. :	AB018281
Description :
HUGO Gene Name :	family with sequence similarity 115, member A (FAM115A)
Clone Name :	hk03873 [Vector Info]
Flexi ORF Clone :	pF1KSDA0738
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4076 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1177 bp

Genome contig ID gi89161213r_143080982
PolyA signal sequence
(GATAAA,-26)
+----*----+----*----+----*----+----
ATCTCTCCAGATAAAGAGCAAAAAGAAATAGATAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAATATAAAGAAAGAAAAAAGACATAGACAATCAATATGTAATGTTAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 r 143180982 143230105 9 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 941 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAF84294	100.0	unnamed protein...	Homo sapiens
Q9Y4C2	99.9	Protein FAM115A.	Homo sapiens
AAH00609	100.0	FAM115A protein...	Homo sapiens
AAQ96853	99.9	unknown [Homo s...	Homo sapiens
Q5R8R3	99.2	Protein FAM115A.	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAGAGAGATAAGAGTTGGTGC

Primer_r
: AACAGGCACTTGAGTAGGAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CAGAGAGATAAGAGTTGGTGC
Primer_r	: AACAGGCACTTGAGTAGGAGG
PCR product length	: 123 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1177 bp
Genome contig ID	gi89161213r_143080982
PolyA signal sequence (GATAAA,-26)	+--------+--------+----*----+---- ATCTCTCCAGATAAAGAGCAAAAAGAAATAGATAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAATATAAAGAAAGAAAAAAGACATAGACAATCAATATGTAATGTTAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	r	143180982	143230105	9	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0738

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information