| HUGE |
Gene/Protein Characteristic Table for KIAA0720 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Mapping | |
| Product ID : | ORK01114 |
|---|---|
| Accession No. : | AB018263 |
| Description : | pleckstrin homology domain containing family G member 5 isoform b. |
| HUGO Gene Name : | pleckstrin homology domain containing, family G (with RhoGef domain) member 5 (PLEKHG5) |
| Clone Name : | hk01741s1 [Vector Info] |
| Flexi ORF Clone : | pF1KA0720
![]() |
| Source : | Human adult brain |
| Note : | We replaced hk01741, former representative clones for KIAA0720 with hk01741s1. (1999/6/16) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4749 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1471 bp Genome contig ID gi89161185r_6348739 PolyA signal sequence
(None) +----*----+----*----+----*----+----
GGGCGCCCGTCGGAGGGCTATGGAGCAGCGGCCGCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
GGGGCTGCGCGGCGGTGGCGGCGGTGAGTTGAGACGCAGGAGGCTAGGGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 r 6448739 6480059 22 100.0 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1091 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
|---|---|---|
| : 1 |
| : GeneBridge 4 | |
| : CCCTGGCTCTACCTTGAAGTG | |
| : GACAGGCCAAGTAGAACACGC | |
| : 130 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |