HUGE

Gene/Protein Characteristic Table for KIAA0714

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01113
Accession No. :	AB018257
Description :	Zinc finger protein 294.
HUGO Gene Name :	ring finger protein 160 (RNF160)
Clone Name :	pf12310 [Vector Info]
Flexi ORF Clone :	pF1KA0714
Source :	Human brain (hippocampus)
Note :	We replaced hj00574, former representative clones for KIAA0714 with pf12310. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 7650 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2307 bp

Genome contig ID gi51511750r_29122345
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TTCTGATTTTTAAATAAATAAAATGTTACTCTTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GTACTTCTCCCTGGCGCCATTCTCCTCCTTCTTTCCCTAGAGCTAACGTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 21 r 29222345 29287039 30 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 1780 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_514851	99.4	zinc finger pro...	Pan troglodytes
O94822	100.0	Zinc finger pro...	Homo sapiens
AAI40791	99.9	Zinc finger pro...	Homo sapiens
XP_001103642	97.8	similar to zinc...	Macaca mulatta
XP_001915227	91.8	similar to Zinc...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001841 1751 1775 PF00097 Zinc finger

HMMSmart IPR011016 1728 1776 SM00744 Zinc finger

ProfileScan IPR001841 1729 1776 PS50089 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001841	1751	1775	PF00097	Zinc finger
HMMSmart	IPR011016	1728	1776	SM00744	Zinc finger
ProfileScan	IPR001841	1729	1776	PS50089	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AAGGTGCCTCCATTTATCAAG

Primer_r
: TAACTACCACTCCGCTTCATG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 21

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GCAAACTGAGCTATTCTTACC
Primer_r	: TTAAGAGTGGCAAAAGGCAGG
PCR product length	: 167 bp
PCR conditions	: 95 °C15 sec60 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2307 bp
Genome contig ID	gi51511750r_29122345
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TTCTGATTTTTAAATAAATAAAATGTTACTCTTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GTACTTCTCCCTGGCGCCATTCTCCTCCTTCTTTCCCTAGAGCTAACGTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	21	r	29222345	29287039	30	99.6	Perfect prediction

Primer_f	: AAGGTGCCTCCATTTATCAAG
Primer_r	: TAACTACCACTCCGCTTCATG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0714

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information