Gene/Protein Characteristic Table for KIAA0707

Length: 6358 bp

Restriction map

The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.

Length of 3'UTR	4464 bp
Genome contig ID	gi89161185f_54686500
PolyA signal sequence (None)	+----*----+----*----+----*----+---- GCACTCCAGCCTGGGTGACAGAGTGATACTGTCTC
Flanking genome sequence (190955 - 191004)	----+----*----+----*----+----*----+----*----+----* AAAAAAAAAAAAAAAAAAAAAAAGAAAGAAAAAAGTAGATATATATGAGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	54786500	54877453	17	99.3	Perfect prediction

Length: 630 aa

This protein sequence is predicted from the revised DNA sequence

Entry Exp ID% Protein Source Q8WXI4 0 100.0 Acyl-coenzyme A... Homo sapiens XP_001152717 0 98.8 thioesterase, a... Pan troglodytes AAL40938 0 100.0 brown fat induc... Homo sapiens BAD97290 0 99.6 thioesterase, a... Homo sapiens XP_001152786 0 99.3 thioesterase, a... Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

No significant homologues

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006683	90	156	PF03061	Thioesterase superfamily
	IPR006683	257	334	PF03061	Thioesterase superfamily
	IPR002913	407	613	PF01852	Lipid-binding START
HMMSmart	IPR002913	407	613	SM00234	Lipid-binding START
ProfileScan	IPR002913	424	570	PS50848	Lipid-binding START

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-