HUGE |
Gene/Protein Characteristic Table for KIAA0669 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00601 |
---|---|
Accession No. : | AB014569 |
Description : | TSC22 domain family protein 2. |
HUGO Gene Name : | TSC22 domain family, member 2 (TSC22D2) |
Clone Name : | hk02346 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0669
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4550 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Features of the protein sequence |
Description | |
---|---|---|
Length: 825 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000580 | 739 | 793 | PD007152 | TSC-22 / Dip / Bun |
HMMPfam | IPR000580 | 739 | 799 | PF01166 | TSC-22 / Dip / Bun |
ScanRegExp | IPR000580 | 739 | 755 | PS01289 | TSC-22 / Dip / Bun |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: ATCCTGGTAGCACTTCTCAAC | |
: TGCTGAGGAGACATTCGGCTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 3 |
: GeneBridge 4 | |
: CCGGCTGAATTAGGCATCTCC | |
: CAATTCAATTCCCTCAGAGGC | |
: 294 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |