HUGE |
Gene/Protein Characteristic Table for KIAA0666 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00599 |
---|---|
Accession No. : | AB014566 |
Description : | Disheveled-associated activator of morphogenesis 1. |
HUGO Gene Name : | dishevelled associated activator of morphogenesis 1 (DAAM1) |
Clone Name : | hk02075 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0666
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4153 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Features of the protein sequence |
Description | |
---|---|---|
Length: 1085 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR010473 | 52 | 240 | PF06371 | Diaphanous GTPase-binding |
IPR010472 | 242 | 448 | PF06367 | Diaphanous FH3 | |
IPR015425 | 608 | 991 | PF02181 | Actin-binding FH2 | |
HMMSmart | IPR003104 | 607 | 1078 | SM00498 | Actin-binding FH2 and DRF autoregulatory |
ProfileScan | IPR014768 | 52 | 427 | PS51232 | GTPase-binding/formin homology 3 |
IPR014767 | 1034 | 1065 | PS51231 | Diaphanous autoregulatory |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CACATCAGTAATAGGACCAGC | |
: GCACTTGGCAGAGATAACTTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 14 |
: GeneBridge 4 | |
: CACATCAGTAATAGGACCAGC | |
: GCACTTGGCAGAGATAACTTG | |
: 184 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |