HUGE

Gene/Protein Characteristic Table for KIAA0663

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00597
Accession No. :	AB014563
Description :	Zinc finger CCCH domain-containing protein 11A.
HUGO Gene Name :	zinc finger CCCH-type containing 11A (ZC3H11A)
Clone Name :	hk02006 [Vector Info]
Flexi ORF Clone :	pF1KSDA0663
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4365 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1719 bp

Genome contig ID gi89161185f_201952678
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
ATACTTGTTTGTGTTTTAAATAAAACTGATGTAGG
Flanking genome sequence
(137193 - 137242)
----+----*----+----*----+----*----+----*----+----*
AAAGTCTTGATGTTGTGAGCTAAGTAATCTTACATCATCATATCAGCCTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 202050656 202089869 17 99.5 Perfect prediction

ContigView(URL based/DAS) 1 r 217847893 217887256 3 97.1 Internal No-hit

ContigView(URL based/DAS) 6 f 66006692 66073272 3 97.0 Both No-hit

Features of the protein sequence	Description

Length: 816 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O75152	100.0	Zinc finger CCC...	Homo sapiens
CAH10566	99.9	hypothetical pr...	Homo sapiens
XP_001157064	99.8	zinc finger CCC...	Pan troglodytes
CAH10525	99.6	hypothetical pr...	Homo sapiens
CAH10530	99.8	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMSmart IPR000571 9 34 SM00356 Zinc finger

IPR000571 38 62 SM00356 Zinc finger

IPR000571 66 92 SM00356 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR000571	9	34	SM00356	Zinc finger
IPR000571	38	62	SM00356	Zinc finger
IPR000571	66	92	SM00356	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGCAGAGGTAGAATGTTCAGG

Primer_r
: TGCGGAACACGAAACATTGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGCAGAGGTAGAATGTTCAGG
Primer_r	: TGCGGAACACGAAACATTGAC
PCR product length	: 174 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1719 bp
Genome contig ID	gi89161185f_201952678
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- ATACTTGTTTGTGTTTTAAATAAAACTGATGTAGG
Flanking genome sequence (137193 - 137242)	----+--------+--------+--------+--------+----* AAAGTCTTGATGTTGTGAGCTAAGTAATCTTACATCATCATATCAGCCTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	202050656	202089869	17	99.5	Perfect prediction
ContigView(URL based/DAS)	1	r	217847893	217887256	3	97.1	Internal No-hit
ContigView(URL based/DAS)	6	f	66006692	66073272	3	97.0	Both No-hit

Gene/Protein Characteristic Table for KIAA0663

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information