| HUGE |
Gene/Protein Characteristic Table for KIAA0659 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00595 |
|---|---|
| Accession No. : | AB014559 |
| Description : | Sn1-specific diacylglycerol lipase alpha. |
| HUGO Gene Name : | diacylglycerol lipase, alpha (DAGLA) |
| Clone Name : | fh22726 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0659
![]() |
| Source : | Human fetal brain |
| Note : | We replaced hk01892, former representative clones for KIAA0659 with fh22726. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5687 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2447 bp Genome contig ID gi51511727f_61104486 PolyA signal sequence
(TATAAA,-7) +----*----+----*----+----*----+----
AGGAGAGACAAATTAATATAGCTTATTCTATAAATFlanking genome sequence
(166502 - 166551) ----+----*----+----*----+----*----+----*----+----*
ATATCTGTATATAAAGGTTTCTGTATATTGTATAGAGCTGTGTATAAACT
Chr f/r start end exon identity class ContigView(URL based/DAS) 11 f 61204486 61270986 20 99.4 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1049 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
| RT-PCR | Description |
|---|
| : GCATACAGAGCTTCAGCCCAG | |
| : TGCCCACATTAGAGGTCCCAG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 11 |
| : GeneBridge 4 | |
| : GCATACAGAGCTTCAGCCCAG | |
| : TGCCCACATTAGAGGTCCCAG | |
| : 186 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |