HUGE

Gene/Protein Characteristic Table for KIAA0642

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01599
Accession No. :	AB014542
Description :	PERQ amino acid-rich with GYF domain-containing protein 2.
HUGO Gene Name :	GRB10 interacting GYF protein 2 (GIGYF2)
Clone Name :	hh02837 [Vector Info]
Flexi ORF Clone :	pF1KSDA0642
Source :	Human adult brain
Note :	We replaced hj03496, former representative clones for KIAA0642 with hh02837. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5937 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1748 bp

Genome contig ID gi89161199f_233170300
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TGCCAGTGTGGAGGAAAATAAAAAAGAACTTAAAT
Flanking genome sequence
(261264 - 261313)
----+----*----+----*----+----*----+----*----+----*
AAAATCTGATTGTATTCTATCTGAGTGCACCTCTTGTACTCACCTTTATG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 233270300 233431562 31 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1329 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI46776	100.0	GIGYF2 protein ...	Homo sapiens
EAW71017	99.9	trinucleotide r...	Homo sapiens
XP_001147374	99.8	trinucleotide r...	Pan troglodytes
XP_850616	96.8	similar to trin...	Canis lupus fam...
Q6Y7W6	98.3	PERQ amino acid...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003169 564 619 PF02213 GYF

HMMSmart IPR003169 564 619 SM00444 GYF

ProfileScan IPR003169 563 611 PS50829 GYF

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003169	564	619	PF02213	GYF
HMMSmart	IPR003169	564	619	SM00444	GYF
ProfileScan	IPR003169	563	611	PS50829	GYF

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTGCCTCCCTCCCTTCTAAAC

Primer_r
: TAGGAGCCCCAACTTTTAATG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTGCCTCCCTCCCTTCTAAAC
Primer_r	: TAGGAGCCCCAACTTTTAATG
PCR product length	: 119 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1748 bp
Genome contig ID	gi89161199f_233170300
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TGCCAGTGTGGAGGAAAATAAAAAAGAACTTAAAT
Flanking genome sequence (261264 - 261313)	----+--------+--------+--------+--------+----* AAAATCTGATTGTATTCTATCTGAGTGCACCTCTTGTACTCACCTTTATG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	233270300	233431562	31	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0642

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information