HUGE

Gene/Protein Characteristic Table for KIAA0631

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00580
Accession No. :	AB014531
Description :	lipidosin.
HUGO Gene Name :	acyl-CoA synthetase bubblegum family member 1 (ACSBG1)
Clone Name :	hh01881s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0631
Source :	Human adult brain
Note :	We replaced hh01881, former representative clones for KIAA0631 with hh01881s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6162 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3972 bp

Genome contig ID gi51511731r_76147228
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTCACAATTTTTGTTAAAAAGGACCTCAAATTAGG
Flanking genome sequence
(99637 - 99588)
----+----*----+----*----+----*----+----*----+----*
GATGAGTCTTCAAGTGCATTATTTCCTCTAACTTCGGAATAGCCCGCGAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 r 76246865 76313913 14 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 729 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96GR2	100.0	Long-chain-fatt...	Homo sapiens
AAG09404	99.9	very long-chain...	Homo sapiens
BAG37108	99.9	unnamed protein...	Homo sapiens
BAG51439	99.7	unnamed protein...	Homo sapiens
BAH12022	99.3	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020644	2.8e-29	26.0	KIAA0837

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000873 279 290 PR00154 AMP-dependent synthetase and ligase

IPR000873 291 299 PR00154 AMP-dependent synthetase and ligase

HMMPfam IPR000873 139 604 PF00501 AMP-dependent synthetase and ligase

ScanRegExp IPR000873 284 295 PS00455 AMP-dependent synthetase and ligase

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000873	279	290	PR00154	AMP-dependent synthetase and ligase
IPR000873	291	299	PR00154	AMP-dependent synthetase and ligase
HMMPfam	IPR000873	139	604	PF00501	AMP-dependent synthetase and ligase
ScanRegExp	IPR000873	284	295	PS00455	AMP-dependent synthetase and ligase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: AGATGTATCCGCAAACTAAAC

Primer_r
: ATGAAAGAGCAGCCGAGTAAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGATGTATCCGCAAACTAAAC
Primer_r	: ATGAAAGAGCAGCCGAGTAAC
PCR product length	: 89 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3972 bp
Genome contig ID	gi51511731r_76147228
PolyA signal sequence (None)	+--------+--------+----*----+---- TTCACAATTTTTGTTAAAAAGGACCTCAAATTAGG
Flanking genome sequence (99637 - 99588)	----+--------+--------+--------+--------+----* GATGAGTCTTCAAGTGCATTATTTCCTCTAACTTCGGAATAGCCCGCGAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	r	76246865	76313913	14	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA0631

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information