HUGE

Gene/Protein Characteristic Table for KIAA0594

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06903
Accession No. :	AB011166
Description :	Structural maintenance of chromosomes protein 5.
HUGO Gene Name :	structural maintenance of chromosomes 5 (SMC5)
Clone Name :	hj02896s1 [Vector Info]
Flexi ORF Clone :	pF1KA0594
Source :	Human adult brain
Note :	We replaced hj02896, former representative clones for KIAA0594 with hj02896s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5906 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2542 bp

Genome contig ID gi89161216f_71963757
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TGCTTTGTTGGTAATAAATCAATATTTTTATATTC
Flanking genome sequence
(195854 - 195903)
----+----*----+----*----+----*----+----*----+----*
TTTTGGTGTATGTTATTTTAAGTGAGAACTATTTTTTATACTCTGAACCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 f 72063757 72159609 25 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1120 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_520066	99.5	SMC5 protein [P...	Pan troglodytes
AAH38225	100.0	Structural main...	Homo sapiens
Q8IY18	99.9	Structural main...	Homo sapiens
CAC39247	99.9	SMC5 protein [H...	Homo sapiens
Q8CG46	89.6	Structural main...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018346	0.00023	20.9	KIAA0803

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003395 71 1099 PF02463 SMC protein

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003395	71	1099	PF02463	SMC protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: ATACCCGCAAAATGATAGAGG

Primer_r
: ACAATATGATCGTCCACACTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AAGTCCTAGTTTCTCCCAATG
Primer_r	: CTGCTACCATTTTTGAACCCC
PCR product length	: 238 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2542 bp
Genome contig ID	gi89161216f_71963757
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TGCTTTGTTGGTAATAAATCAATATTTTTATATTC
Flanking genome sequence (195854 - 195903)	----+--------+--------+--------+--------+----* TTTTGGTGTATGTTATTTTAAGTGAGAACTATTTTTTATACTCTGAACCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	f	72063757	72159609	25	99.5	Perfect prediction

Primer_f	: ATACCCGCAAAATGATAGAGG
Primer_r	: ACAATATGATCGTCCACACTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0594

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information