HUGE

Gene/Protein Characteristic Table for KIAA0590

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00104
Accession No. :	AB011162
Description :	Intraflagellar transport 140 homolog.
HUGO Gene Name :	intraflagellar transport 140 homolog (Chlamydomonas) (IFT140)
Clone Name :	hj02755 [Vector Info]
Flexi ORF Clone :	pF1KA0590
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4962 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 1468 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10359	100.0	intraflagellar ...	synthetic construct
XP_001497463	84.2	similar to intr...	Equus caballus
NP_598887	81.5	intraflagellar ...	Mus musculus
AAI39006	81.4	Intraflagellar ...	Mus musculus
ABB72790	81.2	intraflagellar ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033005	0.00012	23.1	KIAA1179

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001680 99 137 PF00400 WD40 repeat

HMMSmart IPR001680 61 95 SM00320 WD40 repeat

IPR001680 97 137 SM00320 WD40 repeat

IPR001680 320 358 SM00320 WD40 repeat

ProfileScan IPR001680 63 146 PS50294 WD40 repeat

IPR001680 105 146 PS50082 WD40 repeat

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001680	99	137	PF00400	WD40 repeat
HMMSmart	IPR001680	61	95	SM00320	WD40 repeat
IPR001680	97	137	SM00320	WD40 repeat
IPR001680	320	358	SM00320	WD40 repeat
ProfileScan	IPR001680	63	146	PS50294	WD40 repeat
IPR001680	105	146	PS50082	WD40 repeat

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CATGTCTGTGTTGGAATACGC

Primer_r
: GAATACGATGGAAGGGTGAAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CATGTCTGTGTTGGAATACGC
Primer_r	: GAATACGATGGAAGGGTGAAC
PCR product length	: 178 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0590

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information