HUGE

Gene/Protein Characteristic Table for KIAA0546

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00095
Accession No. :	AB011118
Description :	Coiled-coil domain-containing protein 131.
HUGO Gene Name :	zinc finger, C3H1-type containing (ZFC3H1)
Clone Name :	ef04555 [Vector Info]
Flexi ORF Clone :	pF1KA0546
Source :
Note :	We replaced hh00504, former representative clones for KIAA0546 with ef04555. (2003/4/2)

Features of the cloned DNA sequence	Description

Length: 7597 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1655 bp

Genome contig ID gi89161190r_70189745
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
AAGAAATTTTAATTTATAATAAAGTTTAACAGTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAGAACAGTTAATATTTGAACTGCTTTGTATTGAAATACTACTTTGTAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 r 70289745 70343866 34 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1919 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW97263	100.0	proline/serine-...	Homo sapiens
O60293	99.9	Zinc finger C3H...	Homo sapiens
XP_509222	99.8	proline/serine-...	Pan troglodytes
XP_001117507	99.1	hypothetical pr...	Macaca mulatta
EAW97261	100.0	proline/serine-...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMSmart IPR003107 1390 1422 SM00386 RNA-processing protein

IPR003107 1424 1455 SM00386 RNA-processing protein

IPR003107 1659 1691 SM00386 RNA-processing protein

IPR003107 1768 1803 SM00386 RNA-processing protein

ProfileScan IPR013026 1370 1443 PS50293 Tetratricopeptide region

IPR013026 1611 1678 PS50293 Tetratricopeptide region

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR003107	1390	1422	SM00386	RNA-processing protein
IPR003107	1424	1455	SM00386	RNA-processing protein
IPR003107	1659	1691	SM00386	RNA-processing protein
IPR003107	1768	1803	SM00386	RNA-processing protein
ProfileScan	IPR013026	1370	1443	PS50293	Tetratricopeptide region
IPR013026	1611	1678	PS50293	Tetratricopeptide region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GATGGCTGTTCTCCTTGTTAG

Primer_r
: TCCTGTAGACTGTTCCTCATC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GATGGCTGTTCTCCTTGTTAG
Primer_r	: TCCTGTAGACTGTTCCTCATC
PCR product length	: 154 (0.7k) bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1655 bp
Genome contig ID	gi89161190r_70189745
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AAGAAATTTTAATTTATAATAAAGTTTAACAGTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGAACAGTTAATATTTGAACTGCTTTGTATTGAAATACTACTTTGTAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	r	70289745	70343866	34	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA0546

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information