HUGE |
Gene/Protein Characteristic Table for KIAA0544 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00557 |
---|---|
Accession No. : | AB011116 |
Description : | Probable E3 ubiquitin-protein ligase MGRN1. |
HUGO Gene Name : | mahogunin, ring finger 1 (MGRN1) |
Clone Name : | hg04431 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0544
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6450 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 4698 bp Genome contig ID gi51511732f_4514870 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
ACTGTATATTTATAGTAATAAAATCATGCAGCAATFlanking genome sequence
(166107 - 166156) ----+----*----+----*----+----*----+----*----+----*
ATCCTGTCTGCTCCTTCCTCCGGGTGCAGCCCTCAGGATTGTGGCTGTTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 16 f 4614870 4680975 19 99.1 Internal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 583 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: CTTTCCATCCCTAGTTCAGAG | |
: GCTTCGACCACCAATCAGTTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 16 |
: GeneBridge 4 | |
: CTTTCCATCCCTAGTTCAGAG | |
: GCTTCGACCACCAATCAGTTC | |
: 172 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |