HUGE

Gene/Protein Characteristic Table for KIAA0544

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00557
Accession No. :	AB011116
Description :	Probable E3 ubiquitin-protein ligase MGRN1.
HUGO Gene Name :	mahogunin, ring finger 1 (MGRN1)
Clone Name :	hg04431 [Vector Info]
Flexi ORF Clone :	pF1KSDA0544
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6450 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4698 bp

Genome contig ID gi51511732f_4514870
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
ACTGTATATTTATAGTAATAAAATCATGCAGCAAT
Flanking genome sequence
(166107 - 166156)
----+----*----+----*----+----*----+----*----+----*
ATCCTGTCTGCTCCTTCCTCCGGGTGCAGCCCTCAGGATTGTGGCTGTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 f 4614870 4680975 19 99.1 Internal No-hit

Features of the protein sequence	Description

Length: 583 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O60291	8.5e-213	100.0	Probable E3 ubi...	Homo sapiens
XP_510786	7.6e-211	96.0	mahogunin, ring...	Pan troglodytes
AAH50389	2.3e-207	100.0	Mahogunin, ring...	Homo sapiens
XP_001367486	4.7e-191	89.0	similar to Prob...	Monodelphis dom...
NP_001070410	2.1e-182	87.9	mahogunin, ring...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067504	6.4e-66	57.2	KIAA1917

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001841 309 347 PF00097 Zinc finger

HMMSmart IPR001841 309 347 SM00184 Zinc finger

ProfileScan IPR001841 309 348 PS50089 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001841	309	347	PF00097	Zinc finger
HMMSmart	IPR001841	309	347	SM00184	Zinc finger
ProfileScan	IPR001841	309	348	PS50089	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CTTTCCATCCCTAGTTCAGAG

Primer_r
: GCTTCGACCACCAATCAGTTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTTTCCATCCCTAGTTCAGAG
Primer_r	: GCTTCGACCACCAATCAGTTC
PCR product length	: 172 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4698 bp
Genome contig ID	gi51511732f_4514870
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- ACTGTATATTTATAGTAATAAAATCATGCAGCAAT
Flanking genome sequence (166107 - 166156)	----+--------+--------+--------+--------+----* ATCCTGTCTGCTCCTTCCTCCGGGTGCAGCCCTCAGGATTGTGGCTGTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	f	4614870	4680975	19	99.1	Internal No-hit

Gene/Protein Characteristic Table for KIAA0544

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information