HUGE

Gene/Protein Characteristic Table for KIAA0542

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01089
Accession No. :	AB011114
Description :	spindle assembly associated Sfi1 homolog isoform b.
HUGO Gene Name :	Sfi1 homolog, spindle assembly associated (yeast) (SFI1)
Clone Name :	hg04325s1 [Vector Info]
Flexi ORF Clone :	pF1KA0542
Source :	Human adult brain
Note :	We replaced hg04325, former representative clones for KIAA0542 with hg04325s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4160 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 131 bp

Genome contig ID gi89161203f_30122261
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
CAAAATGCTTTGCAATTAAATGAATTACTGTTCAG
Flanking genome sequence
(222276 - 222325)
----+----*----+----*----+----*----+----*----+----*
AAGTCTCCCACTTTTCATACAAAAATACTGTGCTACTGATACAGTTGAAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 22 f 30222261 30344535 32 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1212 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11202	100.0	spindle assembl...	synthetic construct
EAW59980	99.9	Sfi1 homolog, s...	Homo sapiens
CAI12881	99.8	Sfi1 homolog, s...	Homo sapiens
XP_001148524	98.6	spindle assembl...	Pan troglodytes
CAI23034	99.8	Sfi1 homolog, s...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTGGGCCTGGACTTTCAACTG

Primer_r
: GAGGTTCTGCTTGGTGGTCTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 22

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTGGGCCTGGACTTTCAACTG
Primer_r	: GAGGTTCTGCTTGGTGGTCTG
PCR product length	: 101 (0.3k) bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	131 bp
Genome contig ID	gi89161203f_30122261
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- CAAAATGCTTTGCAATTAAATGAATTACTGTTCAG
Flanking genome sequence (222276 - 222325)	----+--------+--------+--------+--------+----* AAGTCTCCCACTTTTCATACAAAAATACTGTGCTACTGATACAGTTGAAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	22	f	30222261	30344535	32	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA0542

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information