HUGE

Gene/Protein Characteristic Table for KIAA0534

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04233
Accession No. :	AB011106
Description :	attractin-like 1.
HUGO Gene Name :	attractin-like 1 (ATRNL1)
Clone Name :	hg03820s1 [Vector Info]
Source :	Human adult brain
Note :	We replaced hg03820, former representative clones for KIAA0534 with hg03820s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 7302 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4215 bp

Genome contig ID gi89161187f_116815357
PolyA signal sequence
(AATAAA,-30)
+----*----+----*----+----*----+----
TATTAAATAAAAACATTGGCTCTTCCAACCCCCAC
Flanking genome sequence
(883138 - 883187)
----+----*----+----*----+----*----+----*----+----*
TGCCAAATGCAGTTTTGTTTTGTTTTTGTTTGTGTTTTATCCTTTCGTGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 f 116915357 117698493 20 99.3 Internal No-hit

Features of the protein sequence	Description

Length: 1028 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAC86914	100.0	unnamed protein...	Homo sapiens
EAW49461	100.0	attractin-like ...	Homo sapiens
Q5VV63	99.9	Attractin-like ...	Homo sapiens
XP_001916550	98.0	similar to attr...	Equus caballus
XP_001787595	97.6	similar to attr...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011120	1.7e-106	68.0	KIAA0548
AB011541	4.8e-14	22.4	KIAA0817
D63483	7.6e-07	26.1	KIAA0149
AB011105	2.8e-06	29.2	KIAA0533
AB011539	7.8e-06	23.9	KIAA0815

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR011498 3 51 PF07646 Kelch repeat type 2

IPR006652 115 167 PF01344 Kelch repeat type 1

IPR006652 169 223 PF01344 Kelch repeat type 1

IPR006652 229 261 PF01344 Kelch repeat type 1

IPR002165 315 358 PF01437 Plexin

IPR002165 364 409 PF01437 Plexin

IPR001304 414 523 PF00059 C-type lectin

IPR002165 538 588 PF01437 Plexin

IPR002165 591 661 PF01437 Plexin

IPR002049 663 706 PF00053 EGF-like

IPR002049 709 755 PF00053 EGF-like

HMMSmart IPR003659 263 306 SM00423 Plexin/semaphorin/integrin

IPR003659 315 358 SM00423 Plexin/semaphorin/integrin

IPR003659 364 409 SM00423 Plexin/semaphorin/integrin

IPR001304 397 522 SM00034 C-type lectin

IPR003659 538 588 SM00423 Plexin/semaphorin/integrin

IPR003659 591 661 SM00423 Plexin/semaphorin/integrin

IPR002049 663 706 SM00180 EGF-like

IPR002049 709 755 SM00180 EGF-like

ProfileScan IPR001304 404 522 PS50041 C-type lectin

IPR002049 663 708 PS50027 EGF-like

IPR002049 709 757 PS50027 EGF-like

ScanRegExp IPR002049 677 711 PS01248 EGF-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011498	3	51	PF07646	Kelch repeat type 2
IPR006652	115	167	PF01344	Kelch repeat type 1
IPR006652	169	223	PF01344	Kelch repeat type 1
IPR006652	229	261	PF01344	Kelch repeat type 1
IPR002165	315	358	PF01437	Plexin
IPR002165	364	409	PF01437	Plexin
IPR001304	414	523	PF00059	C-type lectin
IPR002165	538	588	PF01437	Plexin
IPR002165	591	661	PF01437	Plexin
IPR002049	663	706	PF00053	EGF-like
IPR002049	709	755	PF00053	EGF-like
HMMSmart	IPR003659	263	306	SM00423	Plexin/semaphorin/integrin
IPR003659	315	358	SM00423	Plexin/semaphorin/integrin
IPR003659	364	409	SM00423	Plexin/semaphorin/integrin
IPR001304	397	522	SM00034	C-type lectin
IPR003659	538	588	SM00423	Plexin/semaphorin/integrin
IPR003659	591	661	SM00423	Plexin/semaphorin/integrin
IPR002049	663	706	SM00180	EGF-like
IPR002049	709	755	SM00180	EGF-like
ProfileScan	IPR001304	404	522	PS50041	C-type lectin
IPR002049	663	708	PS50027	EGF-like
IPR002049	709	757	PS50027	EGF-like
ScanRegExp	IPR002049	677	711	PS01248	EGF-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 878 DLVQFFVTFFSCFLSLLLVAAVV 900 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	878	DLVQFFVTFFSCFLSLLLVAAVV	900	PRIMARY	23

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAAGGAATACAAGCCATCTGG

Primer_r
: GAACACTGGCATGCACACCTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CAAGGAATACAAGCCATCTGG
Primer_r	: GAACACTGGCATGCACACCTG
PCR product length	: 156 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	4215 bp
Genome contig ID	gi89161187f_116815357
PolyA signal sequence (AATAAA,-30)	+--------+--------+----*----+---- TATTAAATAAAAACATTGGCTCTTCCAACCCCCAC
Flanking genome sequence (883138 - 883187)	----+--------+--------+--------+--------+----* TGCCAAATGCAGTTTTGTTTTGTTTTTGTTTGTGTTTTATCCTTTCGTGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	f	116915357	117698493	20	99.3	Internal No-hit

Gene/Protein Characteristic Table for KIAA0534

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information