HUGE |
Gene/Protein Characteristic Table for KIAA0528 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00093 |
---|---|
Accession No. : | AB011100 |
Description : | |
HUGO Gene Name : | |
Clone Name : | fj15856 [Vector Info] |
Flexi ORF Clone : | pF1KA0528
![]() |
Source : | Human fetal brain |
Note : | We replaced hg02576, former representative clones for KIAA0528 with fj15856. (2000/1/08) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4186 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1174 bp Genome contig ID gi89161190r_22392843 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
TAATTTTATTTTTTAAATAAAAAGTGTATAAAAATFlanking genome sequence
(99944 - 99895) ----+----*----+----*----+----*----+----*----+----*
AAACTGGAATATTCCTAAATCTCTTTTTTACCTCCATCATATACTACTGT
Chr f/r start end exon identity class ContigView(URL based/DAS) 12 r 22492787 22588360 24 99.6 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1003 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000008 | 24 | 36 | PR00360 | C2 calcium-dependent membrane targeting |
IPR000008 | 48 | 61 | PR00360 | C2 calcium-dependent membrane targeting | |
IPR000008 | 73 | 81 | PR00360 | C2 calcium-dependent membrane targeting | |
HMMPfam | IPR000008 | 8 | 93 | PF00168 | C2 calcium-dependent membrane targeting |
HMMSmart | IPR000008 | 7 | 108 | SM00239 | C2 calcium-dependent membrane targeting |
ProfileScan | IPR000008 | 1 | 93 | PS50004 | C2 calcium-dependent membrane targeting |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: GAACCGTAGCAAAGATGGAAC | |
: ACTTTTCTCCATTGTCCCCAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 12 |
: GeneBridge 4 | |
: GAACCGTAGCAAAGATGGAAC | |
: ACTTTTCTCCATTGTCCCCAC | |
: 198 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |