HUGE

Gene/Protein Characteristic Table for KIAA0528

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00093
Accession No. :	AB011100
Description :
HUGO Gene Name :
Clone Name :	fj15856 [Vector Info]
Flexi ORF Clone :	pF1KA0528
Source :	Human fetal brain
Note :	We replaced hg02576, former representative clones for KIAA0528 with fj15856. (2000/1/08)

Features of the cloned DNA sequence	Description

Length: 4186 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1174 bp

Genome contig ID gi89161190r_22392843
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TAATTTTATTTTTTAAATAAAAAGTGTATAAAAAT
Flanking genome sequence
(99944 - 99895)
----+----*----+----*----+----*----+----*----+----*
AAACTGGAATATTCCTAAATCTCTTTTTTACCTCCATCATATACTACTGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 r 22492787 22588360 24 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 1003 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001147809	99.8	hypothetical pr...	Pan troglodytes
XP_534864	98.7	similar to CG64...	Canis lupus fam...
NP_001125095	98.3	hypothetical pr...	Pongo abelii
XP_866129	97.9	similar to CG64...	Canis lupus fam...
NP_084173	96.2	hypothetical pr...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011110	0.00015	22.2	KIAA0538

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000008 24 36 PR00360 C2 calcium-dependent membrane targeting

IPR000008 48 61 PR00360 C2 calcium-dependent membrane targeting

IPR000008 73 81 PR00360 C2 calcium-dependent membrane targeting

HMMPfam IPR000008 8 93 PF00168 C2 calcium-dependent membrane targeting

HMMSmart IPR000008 7 108 SM00239 C2 calcium-dependent membrane targeting

ProfileScan IPR000008 1 93 PS50004 C2 calcium-dependent membrane targeting

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000008	24	36	PR00360	C2 calcium-dependent membrane targeting
IPR000008	48	61	PR00360	C2 calcium-dependent membrane targeting
IPR000008	73	81	PR00360	C2 calcium-dependent membrane targeting
HMMPfam	IPR000008	8	93	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR000008	7	108	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR000008	1	93	PS50004	C2 calcium-dependent membrane targeting

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GAACCGTAGCAAAGATGGAAC

Primer_r
: ACTTTTCTCCATTGTCCCCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GAACCGTAGCAAAGATGGAAC
Primer_r	: ACTTTTCTCCATTGTCCCCAC
PCR product length	: 198 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1174 bp
Genome contig ID	gi89161190r_22392843
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TAATTTTATTTTTTAAATAAAAAGTGTATAAAAAT
Flanking genome sequence (99944 - 99895)	----+--------+--------+--------+--------+----* AAACTGGAATATTCCTAAATCTCTTTTTTACCTCCATCATATACTACTGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	r	22492787	22588360	24	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA0528

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information