HUGE

Gene/Protein Characteristic Table for KIAA0490

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK07648
Accession No. :	AB007959
Description :	Helix-loop-helix protein 2.
HUGO Gene Name :
Clone Name :	hh00727 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6075 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 5511 bp

Genome contig ID gi89161185f_116081990
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TTGACATAGAAAAATAAACATATCCAGATATACTC
Flanking genome sequence
(106073 - 106122)
----+----*----+----*----+----*----+----*----+----*
ACCCGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 116181990 116188061 1 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 135 aa
Result of homology search against nr database (FASTA output)
No significant homologues
Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CAGGACGTGGTTGAGATAGGA
Primer_r	: CTTCGCCGACTCCGCAAATTG
PCR product length	: 111 bp
PCR conditions	: 95 °C15 sec68 °C60 sec32 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	5511 bp
Genome contig ID	gi89161185f_116081990
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TTGACATAGAAAAATAAACATATCCAGATATACTC
Flanking genome sequence (106073 - 106122)	----+--------+--------+--------+--------+----* ACCCGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	116181990	116188061	1	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0490

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information