HUGE

Gene/Protein Characteristic Table for KIAA0479

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK00547
Accession No. :	AB007948
Description :	Nicotinamide mononucleotide adenylyltransferase 2.
HUGO Gene Name :	nicotinamide nucleotide adenylyltransferase 2 (NMNAT2)
Clone Name :	hh00797 [Vector Info]
Flexi ORF Clone :	pF1KSDA0479
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5431 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4407 bp

Genome contig ID gi89161185r_181384001
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
AATGTTTCAATTATGTTAATAAATAAGACAATGCT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACAAGAGTCTTGTGTCTTGGTCAAGAACTTTCTCTGTGAATTGCAGCATT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 181484001 181654125 11 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 340 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001109387	1.4e-151	99.4	similar to nico...	Macaca mulatta
Q9BZQ4	6.2e-135	100.0	Nicotinamide mo...	Homo sapiens
Q5RBL5	1.6e-134	99.7	Nicotinamide mo...	Pongo abelii
XP_001489645	3.1e-134	99.3	similar to nico...	Equus caballus
BAF84079	1.5e-133	99.3	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004820 45 309 PF01467 Cytidylyltransferase

HMMTigr IPR005248 45 335 TIGR00482 Probable nicotinate-nucleotide adenylyltransferase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004820	45	309	PF01467	Cytidylyltransferase
HMMTigr	IPR005248	45	335	TIGR00482	Probable nicotinate-nucleotide adenylyltransferase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ACCACCAAGACCCACGTTATC
Primer_r	: ATCTGAATGTGCCCTTTGGTG
PCR product length	: 71 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4407 bp
Genome contig ID	gi89161185r_181384001
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AATGTTTCAATTATGTTAATAAATAAGACAATGCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACAAGAGTCTTGTGTCTTGGTCAAGAACTTTCTCTGTGAATTGCAGCATT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	181484001	181654125	11	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA0479

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information