HUGE

Gene/Protein Characteristic Table for KIAA0464

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :
Accession No. :	AB007933
Description :	Carboxyl-terminal PDZ ligand of neuronal nitric oxide synthase protein.
HUGO Gene Name :	nitric oxide synthase 1 (neuronal) adaptor protein (NOS1AP)
Clone Name :	hg01093 [Vector Info]
Flexi ORF Clone :	pF1KA0464
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6667 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
NO NO

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 971 bp

Genome contig ID gi89161185f_160206205
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CCCTCCACTGGGCAGTGGTGGTCAGTTTTTACTGC
Flanking genome sequence
(398649 - 398698)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAGAAAAAAGAGAAAGAAAAAAAAGAATGAATGCAAGCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 160306205 160604852 10 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 586 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001115782	1.6e-183	98.0	similar to nitr...	Macaca mulatta
O75052	1.7e-161	100.0	Carboxyl-termin...	Homo sapiens
AAI43772	4.3e-159	99.0	Unknown (protei...	Homo sapiens
XP_001789596	1.7e-156	97.2	similar to nitr...	Bos taurus
NP_001103455	3.6e-150	94.7	C-terminal PDZ ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006020 112 255 PF00640 Phosphotyrosine interaction region

HMMSmart IPR006020 107 258 SM00462 Phosphotyrosine interaction region

ProfileScan IPR006020 109 250 PS01179 Phosphotyrosine interaction region

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006020	112	255	PF00640	Phosphotyrosine interaction region
HMMSmart	IPR006020	107	258	SM00462	Phosphotyrosine interaction region
ProfileScan	IPR006020	109	250	PS01179	Phosphotyrosine interaction region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTAAGTGATTTGGAGCAGCAG
Primer_r	: TGTAGGGTGAGCATGGAATTG
PCR product length	: 188 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	NO	NO
Warning for coding interruption:	YES	NO

Length of 3'UTR	971 bp
Genome contig ID	gi89161185f_160206205
PolyA signal sequence (None)	+--------+--------+----*----+---- CCCTCCACTGGGCAGTGGTGGTCAGTTTTTACTGC
Flanking genome sequence (398649 - 398698)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAGAAAAAAGAGAAAGAAAAAAAAGAATGAATGCAAGCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	160306205	160604852	10	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0464

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information