HUGE

Gene/Protein Characteristic Table for KIAA0460

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK05602
Accession No. :	AB007929
Description :
HUGO Gene Name :
Clone Name :	bj00064 [Vector Info]
Flexi ORF Clone :	pF1KA0460
Source :	Human adult brain
Note :	We replaced hg00776, former representative clones for KIAA0460 with bj00064. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4581 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 222 bp

Genome contig ID gi89161185f_148503842
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTGCACTTATCTACCTTCCCCAAGTTGTTTGTATT
Flanking genome sequence
(208816 - 208865)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAAGTAAAGAAACACAACCAAAGCCATTTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 148603842 148712656 11 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1452 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG51793	99.8	unnamed protein...	Homo sapiens
XP_001489528	96.3	similar to CG15...	Equus caballus
XP_540301	96.0	similar to CG15...	Canis lupus fam...
XP_860674	94.8	similar to CG15...	Canis lupus fam...
XP_860613	94.2	similar to CG15...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006903 62 125 PF04818 Protein of unknown function DUF618

HMMSmart IPR006569 17 137 SM00582 Regulation of nuclear pre-mRNA protein

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006903	62	125	PF04818	Protein of unknown function DUF618
HMMSmart	IPR006569	17	137	SM00582	Regulation of nuclear pre-mRNA protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GTAGATAAGTGCAATGGGAGG
Primer_r	: ACATTGGAAGTAGGAGTTTGG
PCR product length	: 163 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	222 bp
Genome contig ID	gi89161185f_148503842
PolyA signal sequence (None)	+--------+--------+----*----+---- TTGCACTTATCTACCTTCCCCAAGTTGTTTGTATT
Flanking genome sequence (208816 - 208865)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAGTAAAGAAACACAACCAAAGCCATTTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	148603842	148712656	11	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0460

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information