| HUGE |
Gene/Protein Characteristic Table for KIAA0436 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00536 |
|---|---|
| Accession No. : | AB007896 |
| Description : | prolyl endopeptidase-like isoform D. |
| HUGO Gene Name : | prolyl endopeptidase-like (PREPL) |
| Clone Name : | hj00011 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0436
![]() |
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4661 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2591 bp Genome contig ID gi89161199r_44299407 PolyA signal sequence
(ATTAAA,-20) +----*----+----*----+----*----+----
TATATTTTGTCTGCTATTAAATACTTCCAAGCCTGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATTTTTGTAATTTTATTTTTTATTCAATTACAAGAATACATACTATAAAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 r 44399407 44442127 14 99.4 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 689 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
| RT-PCR | Description |
|---|
| : ACTTACCGGGCACTTCTTATG | |
| : TGTTCTTTAGGGGTAGGTTCC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 2 |
| : GeneBridge 4 | |
| : ACTTACCGGGCACTTCTTATG | |
| : TGTTCTTTAGGGGTAGGTTCC | |
| : 204 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |