HUGE

Gene/Protein Characteristic Table for KIAA0432

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04510
Accession No. :	AB007892
Description :	Cell division cycle 5-like protein.
HUGO Gene Name :
Clone Name :	hh01859s1 [Vector Info]
Source :	Human adult brain
Note :	We replaced hh01859, former representative clones for KIAA0432 with hh01859s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6201 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3710 bp

Genome contig ID gi89161210f_44363457
PolyA signal sequence
(ATTAAA,-23)
+----*----+----*----+----*----+----
AAGCAACTTTAAATTAAAAAAATTGTTTTTAAAAT
Flanking genome sequence
(162684 - 162733)
----+----*----+----*----+----*----+----*----+----*
ATATTCTTCCTTTTATGTTTATTTAGTAAATTTAGGTAATGTATACTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 f 44463457 44526139 16 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 827 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_532156	98.4	similar to CDC5...	Canis lupus fam...
Q99459	100.0	Cell division c...	Homo sapiens
XP_001100220	99.8	similar to CDC5...	Macaca mulatta
BAG54722	99.9	unnamed protein...	Homo sapiens
XP_001502528	98.9	similar to CDC5...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR014778 33 79 PF00249 Myb

IPR014778 85 129 PF00249 Myb

HMMSmart IPR001005 32 81 SM00717 SANT

IPR001005 84 131 SM00717 SANT

ProfileScan IPR001005 28 79 PS50090 SANT

IPR001005 80 129 PS50090 SANT

ScanRegExp IPR001005 88 96 PS00037 SANT

IPR001005 107 129 PS00334 SANT

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR014778	33	79	PF00249	Myb
IPR014778	85	129	PF00249	Myb
HMMSmart	IPR001005	32	81	SM00717	SANT
IPR001005	84	131	SM00717	SANT
ProfileScan	IPR001005	28	79	PS50090	SANT
IPR001005	80	129	PS50090	SANT
ScanRegExp	IPR001005	88	96	PS00037	SANT
IPR001005	107	129	PS00334	SANT

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GATAAAGCTGCCCAAAGAGAC

Primer_r
: CATCTCAAGTTCATCCTCATC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 18

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GTGACTGCAGACTTAATGTTG
Primer_r	: CAATAGCCCAAAAGACCAATC
PCR product length	: 127 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3710 bp
Genome contig ID	gi89161210f_44363457
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- AAGCAACTTTAAATTAAAAAAATTGTTTTTAAAAT
Flanking genome sequence (162684 - 162733)	----+--------+--------+--------+--------+----* ATATTCTTCCTTTTATGTTTATTTAGTAAATTTAGGTAATGTATACTTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	f	44463457	44526139	16	99.3	Perfect prediction

Primer_f	: GATAAAGCTGCCCAAAGAGAC
Primer_r	: CATCTCAAGTTCATCCTCATC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0432

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information