| HUGE |
Gene/Protein Characteristic Table for KIAA0397 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK01082 |
|---|---|
| Accession No. : | AB007857 |
| Description : | RUN and TBC1 domain containing 1 isoform 1. |
| HUGO Gene Name : | small G protein signaling modulator 2 (SGSM2) |
| Clone Name : | fj00010 [Vector Info] |
| Flexi ORF Clone : | pF1KA0397
![]() |
| Source : | Human fetal brain |
| Note : | We replaced hg00184, former representative clones for KIAA0397 with fj00010. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4734 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 1538 bp Genome contig ID gi51511734f_2087639 PolyA signal sequence
(AATAAA,-25) +----*----+----*----+----*----+----
GTAACAGACCAATAAACAACATTTGTCAACACTGGFlanking genome sequence
(143465 - 143514) ----+----*----+----*----+----*----+----*----+----*
AGCCTCTGGGACTGGACACTGAGAGACCACGTGCCTTCTTTAAGCTCCAC
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 f 2187558 2231102 23 99.7 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1016 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR | Description |
|---|
| : TCTGCTCCTCACAAAACCACG | |
| : ATTGTCCATCCTTGTTGTCCG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 17 |
| : GeneBridge 4 | |
| : TCTGCTCCTCACAAAACCACG | |
| : ATTGTCCATCCTTGTTGTCCG | |
| : 99 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |