HUGE |
Gene/Protein Characteristic Table for KIAA0391 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01081 |
---|---|
Accession No. : | AB002389 |
Description : | |
HUGO Gene Name : | |
Clone Name : | hj00118 [Vector Info] |
Flexi ORF Clone : | pF1KA0391
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5677 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 3614 bp Genome contig ID gi51511730f_34561528 PolyA signal sequence
(AATAAA,-17) +----*----+----*----+----*----+----
ACACAGATGAATAAATGTAATAAAATTTGAGAAATFlanking genome sequence
(255045 - 255094) ----+----*----+----*----+----*----+----*----+----*
AATCTTTACTTTTATCATCTCCATTTATGCTTTTTCATGATGTCCTGACG
Chr f/r start end exon identity class ContigView(URL based/DAS) 14 f 34661528 34816571 8 99.3 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 571 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: ATTTCTATGGCTTCCCCTCTG | |
: TGAGCAGAAAGGAAATAGGAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 14 |
: GeneBridge 4 | |
: ATTTCTATGGCTTCCCCTCTG | |
: TGAGCAGAAAGGAAATAGGAC | |
: 131 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |